Incidental Mutation 'R7452:Nemf'
ID 605534
Institutional Source Beutler Lab
Gene Symbol Nemf
Ensembl Gene ENSMUSG00000020982
Gene Name nuclear export mediator factor
Synonyms 1500011I12Rik, 4933405E14Rik, Sdccag1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7452 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 69310522-69357165 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 69337959 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021368]
AlphaFold Q8CCP0
Predicted Effect probably null
Transcript: ENSMUST00000021368
SMART Domains Protein: ENSMUSP00000021368
Gene: ENSMUSG00000020982

DomainStartEndE-ValueType
Pfam:FbpA 6 523 5.5e-42 PFAM
Pfam:DUF814 530 630 9e-27 PFAM
low complexity region 697 708 N/A INTRINSIC
low complexity region 861 879 N/A INTRINSIC
low complexity region 894 918 N/A INTRINSIC
Pfam:DUF3441 956 1055 9.8e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the ribosome quality control complex. The encoded protein facilitates the recognition and ubiquitination of stalled 60S subunits by the ubiquitin ligase listerin. A similar protein in fly functions as a tumor suppressor. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,245,671 S595P probably benign Het
A2m C A 6: 121,641,332 Q195K probably damaging Het
Abcg4 C T 9: 44,279,600 G249R probably damaging Het
Actn1 T C 12: 80,183,602 T293A probably benign Het
Adamts5 T A 16: 85,877,981 T432S probably benign Het
Adh5 A G 3: 138,454,745 T347A probably benign Het
Agbl5 A G 5: 30,893,391 D432G probably damaging Het
Ank3 A G 10: 69,899,051 T797A possibly damaging Het
Aoc1 T G 6: 48,908,790 V743G probably benign Het
Arap2 A T 5: 62,676,549 S858R probably benign Het
Arid1a A C 4: 133,753,127 V162G possibly damaging Het
Armc9 A G 1: 86,213,092 D588G possibly damaging Het
Art3 A G 5: 92,392,680 Y94C probably damaging Het
Btaf1 T A 19: 36,969,127 D444E probably damaging Het
Cav2 A G 6: 17,282,076 H111R probably damaging Het
Ccdc148 A G 2: 58,827,584 L469P probably damaging Het
Celsr2 T A 3: 108,413,090 E802V possibly damaging Het
Cfap57 T C 4: 118,595,784 D574G probably damaging Het
Chd7 A C 4: 8,854,731 D2024A probably benign Het
Corin T A 5: 72,435,247 D269V possibly damaging Het
Cyp4a12a A T 4: 115,327,598 I359F probably damaging Het
Defb6 T C 8: 19,225,524 L7P probably damaging Het
Dnah7c A T 1: 46,647,036 M1817L possibly damaging Het
Dock3 A G 9: 106,989,465 F682S probably damaging Het
Enpep T A 3: 129,271,403 Y879F possibly damaging Het
Enpp2 T C 15: 54,866,736 N462S probably damaging Het
Ephb3 T C 16: 21,217,357 probably null Het
F7 C T 8: 13,035,215 H414Y probably benign Het
Fbn1 T C 2: 125,505,455 H50R possibly damaging Het
Fig4 T C 10: 41,240,637 D586G possibly damaging Het
Fryl A G 5: 73,023,988 L2825P probably damaging Het
Gal3st2 T A 1: 93,872,518 H30Q possibly damaging Het
Gm12886 G A 4: 121,417,474 Q70* probably null Het
Gm8104 A C 14: 43,110,044 T190P probably benign Het
Hps3 A T 3: 20,011,428 N749K probably damaging Het
Hr A G 14: 70,571,486 T1101A probably damaging Het
Htatip2 T A 7: 49,773,326 S210T probably benign Het
Ift80 T C 3: 68,994,282 probably null Het
Iqgap1 A G 7: 80,760,829 V212A possibly damaging Het
Itih5 A G 2: 10,238,796 E448G probably damaging Het
Kdm5b T C 1: 134,624,948 C1221R probably damaging Het
Lrrc72 T C 12: 36,212,693 Y52C probably benign Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mdn1 T C 4: 32,739,030 I3617T possibly damaging Het
Mtpap T A 18: 4,379,705 H98Q possibly damaging Het
Neto1 A T 18: 86,498,931 I458L probably benign Het
Nfam1 T A 15: 83,014,962 M128L probably benign Het
Olfr1279 A G 2: 111,306,921 T239A probably damaging Het
Olfr1383 C A 11: 49,524,381 H219Q probably benign Het
Olfr501-ps1 C T 7: 108,508,593 T179I unknown Het
Olfr914 A T 9: 38,607,088 I208F probably benign Het
P2ry14 C T 3: 59,116,045 G7D probably benign Het
Pde11a A G 2: 76,136,414 Y564H probably damaging Het
Pex5l C T 3: 33,004,318 V262I probably benign Het
Poli A G 18: 70,508,978 V717A possibly damaging Het
Prdm14 A T 1: 13,125,559 W93R probably damaging Het
Rbm46 T C 3: 82,864,121 M396V probably benign Het
Rcor2 T C 19: 7,271,222 V212A probably benign Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Skp2 T A 15: 9,113,832 Q366L probably damaging Het
Slc13a3 A T 2: 165,427,114 S312T probably benign Het
Sstr1 T C 12: 58,213,356 L255P probably damaging Het
Steap3 T C 1: 120,227,855 E458G possibly damaging Het
Sv2b T A 7: 75,147,713 D311V probably damaging Het
Tmem132b A G 5: 125,638,268 D347G probably benign Het
Tmem161a A G 8: 70,177,488 D108G probably damaging Het
Traf5 T A 1: 191,999,831 I47F Het
Trp53bp2 C T 1: 182,446,568 Q95* probably null Het
Ttn G T 2: 76,877,143 probably null Het
Usf3 T C 16: 44,220,034 S1626P probably benign Het
Usp3 T C 9: 66,566,898 R33G probably benign Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Other mutations in Nemf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Nemf APN 12 69344986 splice site probably benign
IGL02499:Nemf APN 12 69322129 missense probably damaging 1.00
IGL03352:Nemf APN 12 69331905 missense probably damaging 1.00
kaempfer UTSW 12 69352336 missense probably benign 0.01
R0335:Nemf UTSW 12 69353803 missense probably benign 0.16
R0538:Nemf UTSW 12 69356314 missense probably damaging 1.00
R0581:Nemf UTSW 12 69322271 missense probably benign
R0909:Nemf UTSW 12 69341610 missense probably damaging 1.00
R1792:Nemf UTSW 12 69312569 missense probably damaging 1.00
R1899:Nemf UTSW 12 69346378 missense probably null
R2080:Nemf UTSW 12 69353786 splice site probably benign
R3704:Nemf UTSW 12 69331130 missense probably damaging 1.00
R3842:Nemf UTSW 12 69331949 missense probably damaging 0.98
R4471:Nemf UTSW 12 69314442 missense probably benign 0.04
R4666:Nemf UTSW 12 69312280 missense probably damaging 1.00
R4720:Nemf UTSW 12 69324288 missense probably benign 0.05
R5198:Nemf UTSW 12 69356047 missense probably damaging 1.00
R5474:Nemf UTSW 12 69316335 missense probably benign 0.03
R6893:Nemf UTSW 12 69352336 missense probably benign 0.01
R7008:Nemf UTSW 12 69341621 missense possibly damaging 0.91
R7008:Nemf UTSW 12 69353793 critical splice donor site probably null
R7098:Nemf UTSW 12 69312467 missense probably damaging 1.00
R7154:Nemf UTSW 12 69316741 critical splice donor site probably null
R8130:Nemf UTSW 12 69356052 missense possibly damaging 0.91
R8340:Nemf UTSW 12 69353885 missense possibly damaging 0.94
R8914:Nemf UTSW 12 69316315 nonsense probably null
R9089:Nemf UTSW 12 69353854 missense probably damaging 1.00
R9150:Nemf UTSW 12 69341046 missense probably benign 0.00
R9228:Nemf UTSW 12 69341319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTGTATGTGTGCTTGACATTC -3'
(R):5'- CCATTAAGATTTCTCCACATAGGAC -3'

Sequencing Primer
(F):5'- GTATGTGTGCTTGACATTCTAAATG -3'
(R):5'- CCAAACTCAGGTCATCAGGTTTGG -3'
Posted On 2019-12-11