Mutagenetix > Incidental Mutation

Incidental Mutation 'R7386:Exoc2'

605538

Institutional Source

Beutler Lab

Gene Symbol

Exoc2

Ensembl Gene

ENSMUSG00000021357

Gene Name

exocyst complex component 2

Synonyms

2410030I24Rik, Sec5l1, Sec5

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R7386 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30813919-30974093 bp(-) (GRCm38)

Type of Mutation

splice site (69 bp from exon)

DNA Base Change (assembly)

T to C at 30906663 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000100010 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]

AlphaFold

Q9D4H1

Predicted Effect

probably null
Transcript: ENSMUST00000021785

SMART Domains

Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	3.2e-10	PFAM
Pfam:Sec5	198	377	3.6e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102946

SMART Domains

Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	2.5e-10	PFAM
Pfam:Sec5	198	377	7.5e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930546C10Rik	A	T	18: 68,950,137	M2K	unknown	Het
6430531B16Rik	A	T	7: 139,976,052	C225*	probably null	Het
Ablim3	T	C	18: 61,821,994	D308G	probably damaging	Het
Adamts17	A	T	7: 66,968,849	K370N	probably benign	Het
Adcy4	T	C	14: 55,778,327	Y435C	probably damaging	Het
Adgb	A	T	10: 10,377,949	F1216I	possibly damaging	Het
Akr1a1	G	A	4: 116,641,054	T98I	probably damaging	Het
Alyref2	G	T	1: 171,503,533		probably benign	Het
Ank3	T	A	10: 69,822,249	H168Q	unknown	Het
Bnc1	A	C	7: 81,974,492	L329R	possibly damaging	Het
Btaf1	G	A	19: 36,958,382	A191T	probably benign	Het
Carmil3	T	G	14: 55,497,747		probably null	Het
Cd200r1	C	A	16: 44,789,848	D143E	probably benign	Het
Cep112	A	G	11: 108,808,681	H98R	probably benign	Het
Cmya5	T	A	13: 93,069,323	Q3346L	probably damaging	Het
Cpne4	T	A	9: 104,872,740	V81E	possibly damaging	Het
Ctnnd2	T	A	15: 30,966,768	M955K	probably damaging	Het
Ctsj	A	T	13: 61,000,559	M307K	possibly damaging	Het
Ddhd2	G	T	8: 25,754,290	R103S	possibly damaging	Het
Depdc5	A	G	5: 32,927,936	T700A	probably benign	Het
Dhx57	A	C	17: 80,267,577	D657E	possibly damaging	Het
Dmbt1	G	A	7: 131,112,236	G1678S	unknown	Het
Dnajb1	A	G	8: 83,610,303	D234G	probably benign	Het
Dsc2	C	T	18: 20,041,926	V431M	possibly damaging	Het
Evi5	C	A	5: 107,809,823		probably null	Het
Foxo3	T	C	10: 42,197,360	D387G	probably benign	Het
Gda	A	G	19: 21,409,886	I325T	probably benign	Het
Gm960	G	A	19: 4,663,558	R285*	probably null	Het
Iqgap1	A	G	7: 80,726,042	S1362P	probably damaging	Het
Klf10	G	T	15: 38,296,949	N282K	possibly damaging	Het
Mettl13	A	G	1: 162,548,154	Y35H	probably damaging	Het
Mill2	A	G	7: 18,858,290	T279A	probably benign	Het
Ncaph2	G	A	15: 89,370,256	W386*	probably null	Het
Nploc4	A	T	11: 120,408,881	S338T	probably benign	Het
Nrip1	T	C	16: 76,293,887	S261G	probably damaging	Het
Olfr1042	A	G	2: 86,159,530	V280A	possibly damaging	Het
Olfr1354	T	A	10: 78,916,843	M1K	probably null	Het
Olfr1388	T	C	11: 49,444,400	F183S	possibly damaging	Het
Palld	A	G	8: 61,532,052	F1060L	unknown	Het
Pfas	C	G	11: 69,003,774	V22L	probably benign	Het
Pygo2	T	G	3: 89,432,821	F175L	probably benign	Het
Rnf2	T	C	1: 151,471,380	E316G	probably damaging	Het
Rtn4	T	A	11: 29,707,772	M642K	probably damaging	Het
Saa3	A	G	7: 46,714,923	C60R	unknown	Het
Scap	A	G	9: 110,373,169	T202A	probably benign	Het
Scn9a	T	A	2: 66,540,550	D562V	probably damaging	Het
Slc6a19	A	T	13: 73,689,891	V163E	possibly damaging	Het
Smc5	G	A	19: 23,215,175	H850Y	possibly damaging	Het
Sqle	G	A	15: 59,330,754	R519Q	probably benign	Het
Sulf1	T	C	1: 12,838,361	Y533H	probably benign	Het
Tex45	A	G	8: 3,487,079	K475R	probably benign	Het
Thbs2	A	G	17: 14,673,150	S923P	possibly damaging	Het
Themis	A	G	10: 28,789,747	D602G	probably benign	Het
Tmem132c	A	G	5: 127,563,926	K1054E	probably benign	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tnrc6c	T	A	11: 117,721,954	C313S	probably benign	Het
Tpm1	T	C	9: 67,028,167	I284M	probably benign	Het
Trpm4	A	T	7: 45,314,640	L722H	possibly damaging	Het
Trub2	T	G	2: 29,786,595	Q41P	probably benign	Het
Usp17le	A	C	7: 104,768,307		probably null	Het
Zfp398	G	A	6: 47,858,950	V148I	probably benign	Het
Zfp40	T	C	17: 23,177,007	E202G	probably damaging	Het
Zfp618	T	A	4: 63,095,385		probably null	Het
Zfp667	T	A	7: 6,305,950	I539N	possibly damaging	Het
Zfp738	A	T	13: 67,670,250	C541S	probably damaging	Het

Other mutations in Exoc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Exoc2	APN	13	30820626	missense	probably benign	0.17
IGL01839:Exoc2	APN	13	30906799	missense	probably damaging	1.00
IGL02092:Exoc2	APN	13	30875277	missense	probably benign	0.09
IGL02245:Exoc2	APN	13	30906859	missense	probably benign	0.10
IGL02267:Exoc2	APN	13	30815321	missense	probably benign
IGL02478:Exoc2	APN	13	30927420	missense	probably benign
IGL02500:Exoc2	APN	13	30911196	missense	probably damaging	1.00
IGL03081:Exoc2	APN	13	30900902	missense	probably benign	0.28
IGL03112:Exoc2	APN	13	30906587	splice site	probably benign
IGL03409:Exoc2	APN	13	30940737	utr 5 prime	probably benign
R0284:Exoc2	UTSW	13	30877625	splice site	probably benign
R0452:Exoc2	UTSW	13	30886327	splice site	probably benign
R0826:Exoc2	UTSW	13	30856797	critical splice acceptor site	probably null
R1251:Exoc2	UTSW	13	30886276	missense	probably benign	0.03
R1367:Exoc2	UTSW	13	30882273	nonsense	probably null
R1501:Exoc2	UTSW	13	30935502	missense	probably benign	0.01
R1593:Exoc2	UTSW	13	30856761	missense	possibly damaging	0.64
R1839:Exoc2	UTSW	13	30906497	splice site	probably benign
R1872:Exoc2	UTSW	13	30822661	missense	probably benign	0.17
R2064:Exoc2	UTSW	13	30935561	missense	probably benign	0.00
R2070:Exoc2	UTSW	13	30815370	missense	probably benign	0.00
R2227:Exoc2	UTSW	13	30864884	missense	probably benign
R2507:Exoc2	UTSW	13	30882365	missense	possibly damaging	0.55
R3965:Exoc2	UTSW	13	30877582	missense	probably benign	0.00
R4601:Exoc2	UTSW	13	30882268	missense	probably benign	0.05
R4914:Exoc2	UTSW	13	30876813	missense	probably benign	0.21
R5299:Exoc2	UTSW	13	30871918	splice site	probably null
R5410:Exoc2	UTSW	13	30864856	missense	probably damaging	0.98
R5461:Exoc2	UTSW	13	30925755	missense	possibly damaging	0.66
R5956:Exoc2	UTSW	13	30820623	missense	probably benign	0.03
R6056:Exoc2	UTSW	13	30900829	missense	probably benign	0.03
R6107:Exoc2	UTSW	13	30876797	missense	probably benign
R6548:Exoc2	UTSW	13	30826064	missense	possibly damaging	0.86
R6692:Exoc2	UTSW	13	30935507	missense	probably benign	0.09
R6969:Exoc2	UTSW	13	30911178	missense	probably benign
R7461:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7467:Exoc2	UTSW	13	30925733	missense	probably damaging	0.98
R7473:Exoc2	UTSW	13	30822630	critical splice donor site	probably null
R7613:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7767:Exoc2	UTSW	13	30876769	missense	probably benign	0.01
R7793:Exoc2	UTSW	13	30911178	missense	probably benign	0.00
R7795:Exoc2	UTSW	13	30876773	nonsense	probably null
R7993:Exoc2	UTSW	13	30906730	critical splice donor site	probably null
R8085:Exoc2	UTSW	13	30940703	missense	probably damaging	1.00
R8330:Exoc2	UTSW	13	30877573	missense	probably benign
R8716:Exoc2	UTSW	13	30911244	missense	probably damaging	1.00
R8735:Exoc2	UTSW	13	30906839	missense	probably damaging	1.00
R8922:Exoc2	UTSW	13	30871855	missense	probably benign	0.05
R9237:Exoc2	UTSW	13	30864875	missense	probably benign
R9243:Exoc2	UTSW	13	30925795	missense	probably benign	0.03
R9365:Exoc2	UTSW	13	30856714	missense	probably benign	0.00
R9731:Exoc2	UTSW	13	30877250	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TGCAGCATAGACACTCACTC -3'
(R):5'- TCGGAAAGACAAGGCAGATTCC -3'

Sequencing Primer
(F):5'- ACCGTCCTCCTGCAAGAG -3'
(R):5'- GACAAGGCAGATTCCACTAGG -3'

Posted On

2019-12-13