Incidental Mutation 'R7390:Ces1a'
ID 605539
Institutional Source Beutler Lab
Gene Symbol Ces1a
Ensembl Gene ENSMUSG00000071047
Gene Name carboxylesterase 1A
Synonyms Gm4976
MMRRC Submission 045472-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7390 (G1)
Quality Score 219.009
Status Validated
Chromosome 8
Chromosomal Location 93746842-93774820 bp(-) (GRCm39)
Type of Mutation splice site (70 bp from exon)
DNA Base Change (assembly) A to C at 93771469 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095211]
AlphaFold E9PYP1
Predicted Effect probably null
Transcript: ENSMUST00000095211
SMART Domains Protein: ENSMUSP00000092836
Gene: ENSMUSG00000071047

DomainStartEndE-ValueType
Pfam:COesterase 1 545 5.7e-169 PFAM
Pfam:Abhydrolase_3 136 286 8.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,992,152 (GRCm39) D291E probably benign Het
Abca9 C T 11: 110,036,487 (GRCm39) V541I probably benign Het
Adamts15 A T 9: 30,822,404 (GRCm39) probably null Het
Adgrg7 A G 16: 56,553,207 (GRCm39) I630T probably damaging Het
Ahnak A G 19: 8,980,569 (GRCm39) I618V probably benign Het
Amotl2 T A 9: 102,608,889 (GRCm39) V801E probably damaging Het
Ankrd17 T C 5: 90,430,779 (GRCm39) T1002A probably benign Het
Bmp7 C T 2: 172,711,998 (GRCm39) D409N probably damaging Het
Bpifb2 A G 2: 153,731,726 (GRCm39) N293S possibly damaging Het
Ccdc162 A G 10: 41,510,044 (GRCm39) C854R probably benign Het
Ccdc171 A G 4: 83,736,304 (GRCm39) E1225G probably damaging Het
Cep350 T C 1: 155,741,833 (GRCm39) E2146G possibly damaging Het
Cfap45 T G 1: 172,368,925 (GRCm39) D444E probably benign Het
Cfap61 T C 2: 145,843,802 (GRCm39) V296A probably benign Het
Cgnl1 C T 9: 71,552,931 (GRCm39) R1011H probably benign Het
Cops4 C T 5: 100,691,741 (GRCm39) R347C probably damaging Het
D16Ertd472e G T 16: 78,344,576 (GRCm39) D177E probably benign Het
Dcdc2a T C 13: 25,291,600 (GRCm39) V195A possibly damaging Het
Dipk2a A G 9: 94,419,436 (GRCm39) S165P probably damaging Het
Dpagt1 G A 9: 44,243,319 (GRCm39) V285I probably benign Het
Dspp G T 5: 104,323,552 (GRCm39) A232S probably damaging Het
Efcab3 T C 11: 104,615,411 (GRCm39) I726T possibly damaging Het
Ephx2 G A 14: 66,347,904 (GRCm39) Het
Fat1 T C 8: 45,405,511 (GRCm39) V754A possibly damaging Het
Fstl3 G A 10: 79,615,865 (GRCm39) C117Y probably damaging Het
Gldc A T 19: 30,077,314 (GRCm39) S953T possibly damaging Het
Gm1123 T C 9: 98,893,033 (GRCm39) N315S probably benign Het
Golga2 A G 2: 32,178,202 (GRCm39) E37G Het
Gpr139 T A 7: 118,743,835 (GRCm39) Q250L probably benign Het
Grik3 C T 4: 125,543,532 (GRCm39) R283C probably damaging Het
Haao A C 17: 84,154,081 (GRCm39) V22G probably damaging Het
Hspg2 T A 4: 137,266,490 (GRCm39) F1884I probably damaging Het
Hyal3 G A 9: 107,462,166 (GRCm39) G67S probably damaging Het
Kbtbd3 T A 9: 4,330,424 (GRCm39) I266K probably benign Het
Klhl26 A C 8: 70,905,499 (GRCm39) L137R probably damaging Het
Krt15 A T 11: 100,026,386 (GRCm39) V100E possibly damaging Het
Lars1 A G 18: 42,343,083 (GRCm39) probably null Het
Lats1 C T 10: 7,577,859 (GRCm39) Q328* probably null Het
Lingo3 G A 10: 80,670,463 (GRCm39) T489I probably damaging Het
Lmtk2 T C 5: 144,066,261 (GRCm39) V65A possibly damaging Het
Lysmd1 T C 3: 95,045,795 (GRCm39) S211P probably damaging Het
Med15 C T 16: 17,540,626 (GRCm39) S21N unknown Het
Nav1 T C 1: 135,512,656 (GRCm39) T135A probably benign Het
Nt5c1a G C 4: 123,102,272 (GRCm39) R66T probably benign Het
Pclo T C 5: 14,732,024 (GRCm39) Y3509H unknown Het
Pkp4 G A 2: 59,140,484 (GRCm39) G397R possibly damaging Het
Ppp1r21 G A 17: 88,856,958 (GRCm39) A138T probably benign Het
Pum3 A T 19: 27,401,642 (GRCm39) V136D probably benign Het
Rab11fip3 A T 17: 26,287,126 (GRCm39) D342E possibly damaging Het
Rcvrn T A 11: 67,590,883 (GRCm39) W156R probably damaging Het
Rspry1 C T 8: 95,349,813 (GRCm39) T67I probably benign Het
Serpina1d T C 12: 103,734,037 (GRCm39) D89G possibly damaging Het
Sgsm3 T A 15: 80,893,021 (GRCm39) V366E possibly damaging Het
Shank3 T G 15: 89,433,515 (GRCm39) L1420R probably benign Het
Sirpb1b A T 3: 15,608,100 (GRCm39) L215* probably null Het
Slc16a13 C T 11: 70,109,797 (GRCm39) V235I probably benign Het
Slc16a14 T C 1: 84,907,187 (GRCm39) D29G probably benign Het
Speer1a T C 5: 11,394,879 (GRCm39) V122A probably benign Het
Spns2 T A 11: 72,347,704 (GRCm39) T329S possibly damaging Het
Sufu G A 19: 46,439,108 (GRCm39) probably null Het
Tll2 A G 19: 41,108,608 (GRCm39) probably null Het
Trim10 G A 17: 37,180,773 (GRCm39) M1I probably null Het
Trim42 A C 9: 97,241,182 (GRCm39) N683K probably damaging Het
Trmt5 A G 12: 73,328,394 (GRCm39) S270P probably damaging Het
Vmn1r59 C A 7: 5,456,986 (GRCm39) R258L possibly damaging Het
Vmn2r32 A G 7: 7,482,851 (GRCm39) L41S probably benign Het
Vmn2r93 A T 17: 18,525,329 (GRCm39) E329V probably damaging Het
Ywhae G T 11: 75,655,487 (GRCm39) E253* probably null Het
Other mutations in Ces1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Ces1a APN 8 93,747,095 (GRCm39) missense probably damaging 1.00
IGL00556:Ces1a APN 8 93,771,687 (GRCm39) missense probably benign 0.03
IGL00841:Ces1a APN 8 93,766,164 (GRCm39) nonsense probably null
IGL01510:Ces1a APN 8 93,771,726 (GRCm39) missense probably damaging 1.00
IGL01511:Ces1a APN 8 93,771,726 (GRCm39) missense probably damaging 1.00
IGL01518:Ces1a APN 8 93,771,726 (GRCm39) missense probably damaging 1.00
IGL01519:Ces1a APN 8 93,771,726 (GRCm39) missense probably damaging 1.00
IGL01520:Ces1a APN 8 93,771,726 (GRCm39) missense probably damaging 1.00
IGL01526:Ces1a APN 8 93,771,726 (GRCm39) missense probably damaging 1.00
IGL01527:Ces1a APN 8 93,771,726 (GRCm39) missense probably damaging 1.00
IGL01828:Ces1a APN 8 93,751,829 (GRCm39) missense probably damaging 0.96
IGL01934:Ces1a APN 8 93,759,278 (GRCm39) missense probably damaging 0.99
IGL02456:Ces1a APN 8 93,766,126 (GRCm39) missense possibly damaging 0.56
IGL02712:Ces1a APN 8 93,762,668 (GRCm39) missense probably damaging 1.00
IGL02982:Ces1a APN 8 93,771,603 (GRCm39) missense probably damaging 1.00
IGL03178:Ces1a APN 8 93,747,517 (GRCm39) missense probably damaging 1.00
IGL03377:Ces1a APN 8 93,766,116 (GRCm39) missense probably damaging 1.00
R0556:Ces1a UTSW 8 93,771,740 (GRCm39) missense probably benign 0.01
R0613:Ces1a UTSW 8 93,752,209 (GRCm39) missense probably benign 0.11
R0627:Ces1a UTSW 8 93,768,671 (GRCm39) missense probably benign 0.03
R0686:Ces1a UTSW 8 93,749,077 (GRCm39) missense probably damaging 1.00
R0724:Ces1a UTSW 8 93,766,141 (GRCm39) missense probably damaging 0.98
R0930:Ces1a UTSW 8 93,749,044 (GRCm39) missense probably benign 0.00
R1063:Ces1a UTSW 8 93,749,044 (GRCm39) missense probably benign 0.00
R1215:Ces1a UTSW 8 93,759,318 (GRCm39) missense probably damaging 1.00
R1381:Ces1a UTSW 8 93,760,659 (GRCm39) missense probably damaging 0.98
R1417:Ces1a UTSW 8 93,749,044 (GRCm39) missense probably benign 0.00
R1850:Ces1a UTSW 8 93,753,954 (GRCm39) missense probably damaging 1.00
R2072:Ces1a UTSW 8 93,774,703 (GRCm39) missense probably benign 0.29
R2074:Ces1a UTSW 8 93,774,703 (GRCm39) missense probably benign 0.29
R2075:Ces1a UTSW 8 93,774,703 (GRCm39) missense probably benign 0.29
R2114:Ces1a UTSW 8 93,766,179 (GRCm39) missense possibly damaging 0.93
R2213:Ces1a UTSW 8 93,751,853 (GRCm39) missense probably damaging 1.00
R2346:Ces1a UTSW 8 93,751,947 (GRCm39) missense probably benign 0.07
R2347:Ces1a UTSW 8 93,751,947 (GRCm39) missense probably benign 0.07
R2483:Ces1a UTSW 8 93,753,969 (GRCm39) missense probably damaging 1.00
R4515:Ces1a UTSW 8 93,747,532 (GRCm39) missense probably damaging 1.00
R4587:Ces1a UTSW 8 93,751,932 (GRCm39) missense probably damaging 1.00
R4691:Ces1a UTSW 8 93,759,287 (GRCm39) missense probably benign 0.00
R4992:Ces1a UTSW 8 93,771,650 (GRCm39) missense probably benign 0.08
R5074:Ces1a UTSW 8 93,759,303 (GRCm39) missense possibly damaging 0.77
R6086:Ces1a UTSW 8 93,753,981 (GRCm39) missense probably benign 0.03
R8926:Ces1a UTSW 8 93,751,841 (GRCm39) missense probably benign 0.05
R9365:Ces1a UTSW 8 93,774,727 (GRCm39) missense probably benign 0.00
R9582:Ces1a UTSW 8 93,766,156 (GRCm39) missense probably benign 0.33
R9636:Ces1a UTSW 8 93,759,263 (GRCm39) missense probably benign 0.17
Z1088:Ces1a UTSW 8 93,752,235 (GRCm39) missense probably benign 0.02
Z1176:Ces1a UTSW 8 93,762,713 (GRCm39) missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- GATAGGGGAACTTTATTCTGCTCAC -3'
(R):5'- CATCAGCTTAGAAGGATCCGC -3'

Sequencing Primer
(F):5'- GCTCACTGATGCATTATCGGAAC -3'
(R):5'- TTAGAAGGATCCGCACAGCCTG -3'
Posted On 2019-12-13