Incidental Mutation 'R7485:Fbln2'
ID605562
Institutional Source Beutler Lab
Gene Symbol Fbln2
Ensembl Gene ENSMUSG00000064080
Gene Namefibulin 2
Synonyms5730577E14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7485 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location91212455-91272540 bp(+) (GRCm38)
Type of Mutationintron (74 bp from exon)
DNA Base Change (assembly) A to G at 91270161 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041544] [ENSMUST00000113498]
Predicted Effect probably null
Transcript: ENSMUST00000041544
SMART Domains Protein: ENSMUSP00000048334
Gene: ENSMUSG00000064080

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:VWC 72 138 8e-35 BLAST
low complexity region 201 215 N/A INTRINSIC
low complexity region 217 233 N/A INTRINSIC
low complexity region 242 262 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ANATO 435 470 1.54e-11 SMART
ANATO 478 509 4.67e-2 SMART
ANATO 511 543 2.78e-9 SMART
low complexity region 546 569 N/A INTRINSIC
EGF_CA 594 635 3.1e-11 SMART
EGF 672 708 1.88e-1 SMART
EGF 712 755 1.33e1 SMART
EGF_CA 756 800 1.34e-6 SMART
EGF_CA 801 846 1.65e-6 SMART
EGF_CA 847 894 2.06e-7 SMART
EGF_CA 895 937 3.56e-11 SMART
EGF_CA 938 979 3.48e-14 SMART
EGF_CA 980 1018 1.7e-8 SMART
EGF_CA 1019 1061 8.18e-11 SMART
EGF_CA 1062 1106 5.08e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113498
SMART Domains Protein: ENSMUSP00000109126
Gene: ENSMUSG00000064080

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:VWC 72 138 8e-35 BLAST
low complexity region 201 215 N/A INTRINSIC
low complexity region 217 233 N/A INTRINSIC
low complexity region 242 262 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ANATO 435 470 1.54e-11 SMART
ANATO 478 509 4.67e-2 SMART
ANATO 511 543 2.78e-9 SMART
low complexity region 546 569 N/A INTRINSIC
EGF_CA 594 635 3.1e-11 SMART
EGF 672 708 1.88e-1 SMART
EGF_CA 709 753 1.34e-6 SMART
EGF_CA 754 799 1.65e-6 SMART
EGF_CA 800 847 2.06e-7 SMART
EGF_CA 848 890 3.56e-11 SMART
EGF_CA 891 932 3.48e-14 SMART
EGF_CA 933 971 1.7e-8 SMART
EGF_CA 972 1014 8.18e-11 SMART
EGF_CA 1015 1059 5.08e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein, which belongs to the fibulin family. This protein binds various extracellular ligands and calcium. It may play a role during organ development, in particular, during the differentiation of heart, skeletal and neuronal structures. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out alle are viable, fertile and grossly normal with no apparent defects in elastic fiber formation in the aorta and skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik C A 7: 131,228,833 P332Q probably damaging Het
Adat3 C T 10: 80,606,400 A24V probably benign Het
Agbl1 A T 7: 76,589,493 E832D unknown Het
Akap8l G A 17: 32,335,571 S347L probably benign Het
Ankmy1 G T 1: 92,876,657 A868E probably damaging Het
Ankrd49 A T 9: 14,782,541 L110* probably null Het
Aoc3 A G 11: 101,337,403 T679A probably damaging Het
Ap1s3 A G 1: 79,614,301 Y111H probably damaging Het
Arnt T A 3: 95,495,348 N777K probably damaging Het
Atp4b A T 8: 13,386,732 M260K probably benign Het
Bcl2l15 A T 3: 103,833,413 D65V probably damaging Het
Bicdl1 G T 5: 115,663,786 S340* probably null Het
Ccdc15 T C 9: 37,315,278 R467G probably benign Het
Ccdc68 T A 18: 69,969,013 M327K possibly damaging Het
Ccdc83 T C 7: 90,223,930 T406A probably benign Het
Ccnf A T 17: 24,249,258 V55D probably damaging Het
Cldn12 A G 5: 5,508,008 F140L probably benign Het
Copb1 A C 7: 114,245,485 I213S possibly damaging Het
Cps1 G A 1: 67,139,857 G76D probably damaging Het
Ctrc A G 4: 141,840,316 W159R probably damaging Het
Cul4a C T 8: 13,140,279 T572M possibly damaging Het
Cyp2c40 A T 19: 39,807,606 Y109* probably null Het
Dcc A G 18: 71,420,246 Y780H probably benign Het
Dctn1 C T 6: 83,189,905 A283V possibly damaging Het
Dio1 T C 4: 107,297,677 D134G probably benign Het
Dlg5 A T 14: 24,148,322 D1514E probably benign Het
Dlg5 A T 14: 24,177,839 L338Q probably damaging Het
Dlgap2 A T 8: 14,829,952 K767N probably damaging Het
Dst A T 1: 34,274,189 I4346F probably benign Het
Dzip1l T C 9: 99,661,012 F507L probably benign Het
Erich2 A T 2: 70,531,765 D300V probably damaging Het
Fam114a2 C T 11: 57,513,689 G83D probably damaging Het
Fam131a C T 16: 20,701,694 A299V probably benign Het
Fbn2 T C 18: 58,071,840 D1177G possibly damaging Het
Fbxl6 T C 15: 76,537,913 probably null Het
Frem3 A T 8: 80,613,336 I753F probably damaging Het
Gfra1 A G 19: 58,300,312 S234P probably damaging Het
Gm5065 C T 7: 5,359,441 R24C probably benign Het
Gtse1 T A 15: 85,868,700 S339T probably benign Het
Hdgfl3 T C 7: 81,900,358 N76S probably benign Het
Herc6 A G 6: 57,581,104 E23G probably benign Het
Hid1 T A 11: 115,354,719 H420L probably damaging Het
Igsf21 G A 4: 140,027,738 T440I probably benign Het
Ikzf4 T A 10: 128,632,582 H676L unknown Het
Il18r1 A G 1: 40,480,980 E177G probably benign Het
Iqch A G 9: 63,508,317 Y558H possibly damaging Het
Kif11 A T 19: 37,410,624 N752I possibly damaging Het
Kntc1 T A 5: 123,786,956 C1111S possibly damaging Het
Krtap9-5 A G 11: 99,948,974 K167R unknown Het
Lipe G T 7: 25,380,611 T704K probably benign Het
Lrrc32 A T 7: 98,498,207 I65F possibly damaging Het
Mogs C T 6: 83,116,207 H179Y probably damaging Het
Mtnr1b A T 9: 15,863,294 Y156* probably null Het
Mtus1 T C 8: 41,084,553 H42R probably benign Het
Mx2 T A 16: 97,545,718 D128E probably benign Het
Myof A T 19: 37,951,491 L829* probably null Het
Naip6 T C 13: 100,283,851 K1304E probably benign Het
Neo1 A C 9: 58,884,543 S1307R probably benign Het
Nipbl A T 15: 8,330,295 D1475E probably benign Het
Nlrp9b T A 7: 20,023,950 F371I probably damaging Het
Nrip1 A T 16: 76,291,450 M1073K probably damaging Het
Obox6 T C 7: 15,833,938 N195D probably damaging Het
Olfr1451 C T 19: 12,999,558 H191Y probably benign Het
Olfr206 A T 16: 59,345,324 C126S probably damaging Het
Olfr347 T A 2: 36,734,638 F106I probably benign Het
Olfr46 T A 7: 140,610,178 I4K probably benign Het
Olfr488 C A 7: 108,255,838 C100F probably damaging Het
Pax7 T C 4: 139,784,569 K232E probably benign Het
Phldb3 C T 7: 24,611,264 probably benign Het
Pkd1l1 C A 11: 8,965,148 V131L Het
Ppp2r5a A G 1: 191,396,335 S28P probably benign Het
Prl8a1 A G 13: 27,574,085 S214P probably damaging Het
Prmt2 A T 10: 76,221,004 C228* probably null Het
Prpf8 C T 11: 75,508,912 R2266* probably null Het
Rabl6 A G 2: 25,584,141 S648P unknown Het
Ralgapa1 T C 12: 55,712,672 K1022R probably damaging Het
Ralgapb T A 2: 158,443,355 D591E probably benign Het
Rprd1a A G 18: 24,506,832 probably null Het
Rsu1 T C 2: 13,216,875 R165G probably damaging Het
Samd8 A G 14: 21,792,423 E334G probably benign Het
Scn9a T A 2: 66,534,217 Q804L probably damaging Het
Sez6 A G 11: 77,973,885 D557G probably benign Het
Sgsm1 A T 5: 113,279,635 probably null Het
Slc17a3 T A 13: 23,855,849 M290K Het
Snd1 T A 6: 28,531,450 V330E probably benign Het
Tceanc2 T C 4: 107,165,655 K45R probably damaging Het
Tg A T 15: 66,696,588 I1375F probably benign Het
Tmem116 T A 5: 121,495,061 I357K Het
Tmem39a G T 16: 38,588,296 R407L possibly damaging Het
Tmem74 A T 15: 43,867,365 M94K probably benign Het
Tpp1 C T 7: 105,749,544 C226Y probably damaging Het
Trbv21 T C 6: 41,202,927 I59T not run Het
Trim11 A G 11: 58,978,637 D133G probably benign Het
Uaca G A 9: 60,846,000 V76I probably damaging Het
Ugt2a3 A G 5: 87,327,680 probably null Het
Vmn2r104 G T 17: 20,029,475 H845N probably benign Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb46 A G 2: 181,423,719 S213P probably benign Het
Zdhhc13 C A 7: 48,811,355 Y346* probably null Het
Zfp280b A T 10: 76,039,241 H318L probably damaging Het
Other mutations in Fbln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Fbln2 APN 6 91266392 missense probably damaging 1.00
IGL01664:Fbln2 APN 6 91233457 missense probably damaging 0.96
IGL02110:Fbln2 APN 6 91234102 missense probably benign 0.01
IGL02227:Fbln2 APN 6 91256367 missense possibly damaging 0.90
IGL02814:Fbln2 APN 6 91265857 nonsense probably null
IGL03287:Fbln2 APN 6 91233494 missense probably damaging 1.00
IGL03412:Fbln2 APN 6 91271781 missense probably damaging 1.00
IGL03014:Fbln2 UTSW 6 91265919 intron probably benign
R0103:Fbln2 UTSW 6 91271550 missense probably benign
R0103:Fbln2 UTSW 6 91271550 missense probably benign
R1563:Fbln2 UTSW 6 91263383 nonsense probably null
R1843:Fbln2 UTSW 6 91265775 missense probably damaging 1.00
R1846:Fbln2 UTSW 6 91256417 missense possibly damaging 0.91
R1994:Fbln2 UTSW 6 91234301 missense probably damaging 1.00
R2431:Fbln2 UTSW 6 91269973 missense probably damaging 0.98
R2443:Fbln2 UTSW 6 91259711 missense probably damaging 1.00
R2925:Fbln2 UTSW 6 91265855 missense probably damaging 1.00
R3030:Fbln2 UTSW 6 91233715 missense probably damaging 1.00
R3758:Fbln2 UTSW 6 91256381 missense probably damaging 1.00
R3854:Fbln2 UTSW 6 91266371 missense probably damaging 1.00
R4006:Fbln2 UTSW 6 91269961 splice site probably null
R4627:Fbln2 UTSW 6 91259767 missense probably damaging 1.00
R4752:Fbln2 UTSW 6 91256243 missense probably benign
R4763:Fbln2 UTSW 6 91270000 missense probably damaging 1.00
R4798:Fbln2 UTSW 6 91269186 missense probably benign 0.03
R4877:Fbln2 UTSW 6 91233495 missense probably damaging 1.00
R4878:Fbln2 UTSW 6 91256995 critical splice donor site probably null
R4937:Fbln2 UTSW 6 91264699 missense probably damaging 0.99
R4969:Fbln2 UTSW 6 91271587 missense possibly damaging 0.64
R4996:Fbln2 UTSW 6 91266010 missense probably benign 0.05
R5344:Fbln2 UTSW 6 91266383 missense probably damaging 1.00
R5681:Fbln2 UTSW 6 91271796 missense probably damaging 1.00
R5838:Fbln2 UTSW 6 91271848 missense possibly damaging 0.55
R6035:Fbln2 UTSW 6 91263353 missense probably damaging 1.00
R6035:Fbln2 UTSW 6 91263353 missense probably damaging 1.00
R6288:Fbln2 UTSW 6 91233281 missense probably damaging 1.00
R6433:Fbln2 UTSW 6 91233272 missense probably damaging 1.00
R6451:Fbln2 UTSW 6 91234259 missense probably benign 0.18
R6491:Fbln2 UTSW 6 91259750 missense possibly damaging 0.68
R6520:Fbln2 UTSW 6 91259659 missense probably damaging 1.00
R6657:Fbln2 UTSW 6 91259750 missense possibly damaging 0.68
R6987:Fbln2 UTSW 6 91234229 missense probably benign 0.00
R7344:Fbln2 UTSW 6 91269973 missense probably damaging 0.98
R7488:Fbln2 UTSW 6 91265863 critical splice donor site probably null
R7571:Fbln2 UTSW 6 91268575 missense probably damaging 1.00
R7667:Fbln2 UTSW 6 91233667 missense probably damaging 1.00
R7776:Fbln2 UTSW 6 91269199 missense probably damaging 1.00
R7779:Fbln2 UTSW 6 91233194 missense probably damaging 1.00
Z1088:Fbln2 UTSW 6 91233346 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGCTCTGAGGCTGAGAC -3'
(R):5'- GCCCAGCAAATACTCTGTCTG -3'

Sequencing Primer
(F):5'- CCTGCCACAATATCCAGGGGAG -3'
(R):5'- CCTGCATGTGTCATTAGGGAAATCC -3'
Posted On2019-12-18