Incidental Mutation 'R7422:Chfr'
ID 605572
Institutional Source Beutler Lab
Gene Symbol Chfr
Ensembl Gene ENSMUSG00000014668
Gene Name checkpoint with forkhead and ring finger domains
Synonyms RNF116, 5730484M20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock # R7422 (G1)
Quality Score 163.009
Status Validated
Chromosome 5
Chromosomal Location 110135842-110171972 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 110162705 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000112519] [ENSMUST00000198066] [ENSMUST00000198633] [ENSMUST00000198633] [ENSMUST00000199557] [ENSMUST00000199672]
AlphaFold Q810L3
Predicted Effect probably null
Transcript: ENSMUST00000014812
SMART Domains Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 512 3.53e0 SMART
Blast:VWA 593 655 3e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000014812
SMART Domains Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 512 3.53e0 SMART
Blast:VWA 593 655 3e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000112519
SMART Domains Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 513 3.63e0 SMART
Blast:VWA 594 656 3e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000112519
SMART Domains Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 513 3.63e0 SMART
Blast:VWA 594 656 3e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198066
Predicted Effect probably null
Transcript: ENSMUST00000198633
SMART Domains Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
RING 231 269 2.63e-4 SMART
low complexity region 324 349 N/A INTRINSIC
RING 371 441 3.63e0 SMART
Blast:VWA 522 584 2e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000198633
SMART Domains Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
RING 231 269 2.63e-4 SMART
low complexity region 324 349 N/A INTRINSIC
RING 371 441 3.63e0 SMART
Blast:VWA 522 584 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199557
SMART Domains Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
SCOP:d1lgpa_ 14 44 4e-5 SMART
PDB:1LGQ|B 16 44 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000199672
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,881,059 C456S probably damaging Het
4930524J08Rik T C 5: 99,979,209 probably benign Het
Adam28 T G 14: 68,626,877 R492S probably damaging Het
Adarb2 G A 13: 8,757,277 A705T possibly damaging Het
Adprhl1 T C 8: 13,222,873 D1295G probably benign Het
Aldh3b3 A G 19: 3,966,476 I365V probably benign Het
Aldh8a1 T C 10: 21,389,097 F208L possibly damaging Het
Ap3b1 G A 13: 94,528,165 V871I unknown Het
Apol7e A T 15: 77,714,352 R6* probably null Het
Arfgap3 T C 15: 83,306,949 E456G probably damaging Het
Arhgef1 T C 7: 24,916,036 L285P probably benign Het
Arhgef7 T A 8: 11,800,861 C315S probably benign Het
Atp9a A T 2: 168,648,593 L829Q probably damaging Het
Babam2 T A 5: 31,731,049 probably null Het
Bptf C T 11: 107,060,558 R2185H probably damaging Het
Brd9 A C 13: 73,954,578 M473L probably benign Het
C7 T C 15: 5,012,056 H456R probably benign Het
Cabp7 C A 11: 4,738,856 A205S probably damaging Het
Catsperb A G 12: 101,588,034 I662M probably damaging Het
Ccl21a T C 4: 42,773,906 M5V probably benign Het
Cdyl G T 13: 35,858,194 R405L possibly damaging Het
Cep89 T C 7: 35,428,247 L538P probably damaging Het
Cercam A G 2: 29,872,880 M209V possibly damaging Het
Cntnap5c T A 17: 58,410,231 Y1269* probably null Het
Col6a2 G T 10: 76,603,336 C833* probably null Het
Cpeb3 T A 19: 37,174,500 I159F probably benign Het
Cplx2 G A 13: 54,378,850 E24K possibly damaging Het
Ctsb A G 14: 63,142,303 T332A probably benign Het
Cyp2j12 T A 4: 96,140,985 T20S probably benign Het
Dcst2 T A 3: 89,366,686 H181Q probably damaging Het
Dnm1l T C 16: 16,318,474 I411V probably benign Het
Dock5 T A 14: 67,809,030 I768F probably benign Het
Dpcr1 T A 17: 35,638,420 T96S probably benign Het
Ecel1 A G 1: 87,149,612 Y625H probably damaging Het
Efl1 T G 7: 82,681,379 S253R probably damaging Het
Elmod1 T A 9: 53,912,843 D287V probably damaging Het
Fam171a2 T C 11: 102,438,665 S423G probably benign Het
Fbxo8 A T 8: 56,569,282 probably null Het
Flnc G T 6: 29,455,471 G2040W probably damaging Het
Fras1 C T 5: 96,673,599 A1405V probably benign Het
Frem3 A C 8: 80,615,763 I1562L probably benign Het
Fxr1 C T 3: 34,049,220 A233V probably damaging Het
Helb A G 10: 120,108,894 F246L probably damaging Het
Hils1 A G 11: 94,968,358 R160G possibly damaging Het
Hoxb6 G T 11: 96,292,684 probably benign Het
Hspa2 A G 12: 76,406,110 E526G probably damaging Het
Hyal5 A T 6: 24,875,984 probably benign Het
Ints6 A T 14: 62,704,775 V503E probably benign Het
Ints9 C T 14: 65,032,298 T479I possibly damaging Het
Jag1 C T 2: 137,085,055 R928H probably benign Het
Lman2 A T 13: 55,351,525 I179N probably damaging Het
Lta T C 17: 35,203,829 S173G probably benign Het
Mki67 G A 7: 135,698,370 P1645L probably damaging Het
Mrc2 A T 11: 105,292,783 probably benign Het
Muc4 T A 16: 32,754,689 M1521K probably benign Het
Mylk3 T G 8: 85,355,244 D438A probably benign Het
Myo7a T A 7: 98,051,626 probably null Het
Nsmce4a G T 7: 130,533,817 Q342K probably benign Het
Olfr1232 T A 2: 89,326,079 I34F probably benign Het
Olfr455 A G 6: 42,538,119 I301T possibly damaging Het
Olfr484 A G 7: 108,124,861 L134P probably damaging Het
Olfr808 A T 10: 129,768,267 Y257F possibly damaging Het
Osbpl6 T A 2: 76,593,386 F864L probably damaging Het
Pla2g4a A G 1: 149,932,687 S2P probably benign Het
Plce1 T C 19: 38,651,885 L525P probably damaging Het
Por A T 5: 135,734,919 M667L probably benign Het
Psma4 T C 9: 54,954,882 Y97H probably benign Het
Qtrt1 A T 9: 21,412,457 H126L probably benign Het
Rab3a A T 8: 70,756,523 Y102F possibly damaging Het
Rnf212 T A 5: 108,731,689 H87L probably benign Het
Rnf216 A G 5: 143,090,836 S98P probably benign Het
Ryr1 G T 7: 29,085,870 R1806S probably benign Het
Scgb1b3 A T 7: 31,375,837 L37F probably benign Het
Sds T C 5: 120,479,189 S37P probably damaging Het
Senp6 A G 9: 80,113,877 R280G probably damaging Het
She T A 3: 89,854,557 I441K possibly damaging Het
Slc6a20b A G 9: 123,607,617 S244P possibly damaging Het
Slc9a3 A T 13: 74,150,885 Y141F probably damaging Het
Slco6c1 A T 1: 97,081,482 H426Q probably benign Het
Smc2 C A 4: 52,440,301 Q16K probably benign Het
Sphkap A C 1: 83,263,826 V1535G probably benign Het
Stard9 C A 2: 120,702,152 N2963K probably benign Het
Sycp2 C T 2: 178,394,151 A248T probably damaging Het
Taar8a T C 10: 24,076,864 L122P probably damaging Het
Tab1 T A 15: 80,160,244 V491E probably benign Het
Tanc1 T C 2: 59,806,344 M857T probably benign Het
Tcirg1 C A 19: 3,899,008 R427L possibly damaging Het
Tmem109 A C 19: 10,871,760 *244G probably null Het
Tox2 A G 2: 163,321,515 Y136C Het
Tubb1 T C 2: 174,457,032 V169A possibly damaging Het
Ubr3 T C 2: 69,953,542 probably null Het
Vmn1r225 T A 17: 20,502,797 F167I probably benign Het
Vmn2r65 A C 7: 84,946,361 W372G probably damaging Het
Vps13a A T 19: 16,750,173 D188E probably damaging Het
Vsnl1 G T 12: 11,326,438 Q149K probably benign Het
Wdr35 A G 12: 9,004,105 N466S probably benign Het
Ywhae T A 11: 75,759,343 S210R probably damaging Het
Zfp28 T A 7: 6,394,749 S728T probably damaging Het
Zfpm1 A G 8: 122,336,959 D919G unknown Het
Other mutations in Chfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Chfr APN 5 110143573 missense possibly damaging 0.94
IGL01479:Chfr APN 5 110144993 unclassified probably benign
IGL02543:Chfr APN 5 110143547 splice site probably null
IGL02657:Chfr APN 5 110154839 missense probably damaging 1.00
IGL03057:Chfr APN 5 110143609 missense probably benign 0.14
PIT4445001:Chfr UTSW 5 110151677 missense possibly damaging 0.88
R0938:Chfr UTSW 5 110164058 missense probably damaging 1.00
R1346:Chfr UTSW 5 110140447 missense probably damaging 1.00
R1561:Chfr UTSW 5 110158808 missense probably benign 0.05
R1602:Chfr UTSW 5 110151665 missense probably benign 0.26
R1658:Chfr UTSW 5 110153169 missense probably damaging 1.00
R2134:Chfr UTSW 5 110144761 splice site probably null
R2234:Chfr UTSW 5 110170863 missense probably damaging 1.00
R4371:Chfr UTSW 5 110136168 missense probably damaging 0.99
R4420:Chfr UTSW 5 110170880 nonsense probably null
R4666:Chfr UTSW 5 110144867 nonsense probably null
R4742:Chfr UTSW 5 110143598 missense probably benign 0.04
R4809:Chfr UTSW 5 110158834 missense probably damaging 1.00
R5490:Chfr UTSW 5 110153129 missense possibly damaging 0.88
R5581:Chfr UTSW 5 110153282 critical splice donor site probably null
R5820:Chfr UTSW 5 110162739 missense possibly damaging 0.94
R6012:Chfr UTSW 5 110144651 critical splice donor site probably null
R7128:Chfr UTSW 5 110143636 missense probably benign 0.33
R7166:Chfr UTSW 5 110158805 missense probably benign
R7278:Chfr UTSW 5 110140360 missense probably benign 0.23
R7393:Chfr UTSW 5 110152358 missense probably damaging 0.98
R7499:Chfr UTSW 5 110151683 missense probably benign 0.40
R8224:Chfr UTSW 5 110160243 critical splice donor site probably null
R8264:Chfr UTSW 5 110152434 missense possibly damaging 0.86
R8325:Chfr UTSW 5 110162763 nonsense probably null
R8333:Chfr UTSW 5 110154937 missense probably benign 0.05
R8823:Chfr UTSW 5 110152392 missense probably damaging 0.96
R9024:Chfr UTSW 5 110158832 missense probably benign 0.26
R9419:Chfr UTSW 5 110169190
X0013:Chfr UTSW 5 110151579 missense probably benign 0.19
Z1176:Chfr UTSW 5 110144895 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGATGCAGGGGCTGAAAC -3'
(R):5'- TTGGTCAGAAAATACAGTGTGTGG -3'

Sequencing Primer
(F):5'- CAGGGGCTGAAACTTGGGTC -3'
(R):5'- TTGACAGTATACATTTGCAGGC -3'
Posted On 2019-12-20