Mutagenetix > Incidental Mutation

Incidental Mutation 'R7831:Crisp4'

605585

Institutional Source

Beutler Lab

Gene Symbol

Crisp4

Ensembl Gene

ENSMUSG00000025774

Gene Name

cysteine-rich secretory protein 4

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7831 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18115191-18145902 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 18128789 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 140 (N140K)

Ref Sequence

ENSEMBL: ENSMUSP00000111001 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026876] [ENSMUST00000115340] [ENSMUST00000115344]

AlphaFold

E9PVG4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000026876
AA Change: N101K

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000026876
Gene: ENSMUSG00000025774
AA Change: N101K

Domain	Start	End	E-Value	Type
transmembrane domain	7	24	N/A	INTRINSIC
SCP	44	188	1.32e-45	SMART
Pfam:Crisp	200	254	4.8e-25	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115340
AA Change: N97K

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000110997
Gene: ENSMUSG00000025774
AA Change: N97K

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
SCP	40	184	1.32e-45	SMART
Pfam:Crisp	196	250	6.2e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115344
AA Change: N140K

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000111001
Gene: ENSMUSG00000025774
AA Change: N140K

Domain	Start	End	E-Value	Type
transmembrane domain	39	61	N/A	INTRINSIC
SCP	83	227	1.32e-45	SMART
Pfam:Crisp	239	293	1.6e-23	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (87/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fertilization consists of a sequence of specific cell-cell interactions culminating in the fusion of the sperm and egg plasma membranes. Recognition, binding, and fusion occur through the interaction of complementary molecules that are localized to specific domains of the sperm and egg plasma membranes. In the sperm, the postacrosomal region or equatorial segment is involved in sperm-egg plasma membrane fusion. The protein encoded by this gene is a member of the cysteine-rich secretory protein (CRISP) family. It is expressed in the epididymis, is secreted into the epididymal lumen, and binds to the postacrosomal region of the sperm head, where it plays a role in sperm-egg fusion. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a null mutation display an impaired acrosome reaction in response to progesterone but are fertile with normal testis morphology and weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	G	A	11: 9,297,404	V2384I	possibly damaging	Het
Acsl1	A	G	8: 46,519,006	D297G	probably benign	Het
Ap2a1	C	A	7: 44,901,012	R944L	probably damaging	Het
Apbb1ip	A	G	2: 22,866,921	Y398C	probably damaging	Het
Atp8a2	A	T	14: 59,773,753	V968D	probably damaging	Het
Becn1	T	C	11: 101,290,453	T341A	probably benign	Het
Card11	G	T	5: 140,873,412	S1126R	possibly damaging	Het
Ccdc51	T	C	9: 109,091,990	L315S	probably damaging	Het
Cdk12	T	C	11: 98,249,827	L1298P	unknown	Het
Cep170b	A	T	12: 112,744,800	D1538V	probably benign	Het
Cfap52	A	T	11: 67,935,956	F348I	possibly damaging	Het
Clip1	A	T	5: 123,613,279	M813K		Het
Col19a1	G	A	1: 24,526,482	T256I	unknown	Het
Col6a3	A	T	1: 90,796,546	C2027*	probably null	Het
Crocc2	G	T	1: 93,215,473	A1266S	probably benign	Het
Cyfip2	G	A	11: 46,196,446	R1206C	probably damaging	Het
Cyp24a1	T	A	2: 170,485,940	M461L	probably damaging	Het
Cyp2a5	C	T	7: 26,835,515	T51I	possibly damaging	Het
Cyp2b19	C	T	7: 26,767,140	H398Y	possibly damaging	Het
Cyp4a29	G	A	4: 115,250,170	V234I	probably benign	Het
Dicer1	T	G	12: 104,708,800	K734N	probably damaging	Het
Dnaic1	T	C	4: 41,614,695		probably null	Het
Entpd3	G	A	9: 120,543,959	G14D	probably damaging	Het
Ermp1	T	C	19: 29,617,967	T634A	probably benign	Het
Evc	C	T	5: 37,319,083	G374D	probably damaging	Het
Fam189b	G	A	3: 89,184,213		probably null	Het
Fcgbp	C	A	7: 28,106,979	T2124K	probably damaging	Het
Fgf8	G	A	19: 45,742,437	P50S	probably benign	Het
Fmnl1	C	T	11: 103,198,173	R1074W	unknown	Het
Galnt18	C	T	7: 111,556,458	V223M	possibly damaging	Het
Galnt2	A	G	8: 124,332,078	N295S	probably benign	Het
Gm9573	T	A	17: 35,618,759	T1512S	unknown	Het
Grip1	T	G	10: 120,018,106	V600G	probably damaging	Het
Insm2	T	A	12: 55,600,538	C356S	probably damaging	Het
Itpr2	T	A	6: 146,291,584	I1672F	probably benign	Het
Kdm1b	T	G	13: 47,050,622	N76K	probably benign	Het
Khnyn	T	A	14: 55,887,846		probably null	Het
Kidins220	C	T	12: 25,061,231	A1167V	possibly damaging	Het
Krt40	T	C	11: 99,541,261	D208G	probably benign	Het
Lars	T	A	18: 42,217,562	D894V	probably benign	Het
Lmx1a	A	T	1: 167,840,952	N266I	probably benign	Het
Mrgprb5	T	A	7: 48,168,249	K246M	probably benign	Het
Mrpl2	G	A	17: 46,648,672	G176R	possibly damaging	Het
Nell1	T	A	7: 49,982,800	F60L	possibly damaging	Het
Nnt	G	A	13: 119,370,094	A453V	possibly damaging	Het
Olfr366	C	T	2: 37,219,711	T74I	probably damaging	Het
Olfr398	A	C	11: 73,984,431	M59R	probably damaging	Het
Olfr697	T	A	7: 106,741,413	I174F	probably damaging	Het
Opa1	A	G	16: 29,648,937	K940R	probably benign	Het
Opn5	A	C	17: 42,580,619	I309S	probably null	Het
P3h3	T	G	6: 124,855,155	E256A	possibly damaging	Het
Pald1	G	T	10: 61,355,814	T65K	probably damaging	Het
Pcnx3	T	C	19: 5,685,961	Y279C	probably damaging	Het
Pik3c2b	G	A	1: 133,071,242	S367N	possibly damaging	Het
Pik3cb	T	C	9: 99,088,613	T342A	probably benign	Het
Pkd1l3	A	T	8: 109,631,358	E837D	possibly damaging	Het
Ppp2r2b	T	A	18: 42,701,532	Y191F	probably benign	Het
Ppp4r4	G	A	12: 103,590,821	E439K	possibly damaging	Het
Pqlc3	T	A	12: 16,997,631		probably null	Het
Ptprk	A	G	10: 28,568,408	I946V	possibly damaging	Het
Ror1	A	G	4: 100,441,098	N556S	probably benign	Het
Ryr3	C	T	2: 112,926,838	A391T	possibly damaging	Het
Selp	G	A	1: 164,145,015		probably null	Het
Setx	T	C	2: 29,157,108	L1866S	probably damaging	Het
Setx	T	A	2: 29,179,854	V2557E	possibly damaging	Het
Slit2	A	G	5: 48,244,683	T805A	probably benign	Het
Sorbs3	T	G	14: 70,203,032	N89T	possibly damaging	Het
Sorl1	C	A	9: 42,089,961	V248L	probably benign	Het
Srebf2	T	A	15: 82,182,087	V612E	probably damaging	Het
Sv2c	T	A	13: 95,976,692	Y583F	probably damaging	Het
Tada1	G	T	1: 166,389,873	R193I	probably damaging	Het
Tnrc6b	C	G	15: 80,880,379	A694G	possibly damaging	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Ttn	C	T	2: 76,881,081	G8372D	unknown	Het
Ube2g2	A	G	10: 77,634,742	T68A		Het
Ubl7	T	G	9: 57,914,635	V89G	possibly damaging	Het
Ush2a	T	A	1: 188,759,841	I3109N	probably damaging	Het
Utp20	T	A	10: 88,762,770	K115*	probably null	Het
Vmn2r26	T	A	6: 124,039,799	Y407*	probably null	Het
Yod1	G	T	1: 130,719,249	V288F	probably damaging	Het
Zbed5	A	C	5: 129,901,957	N249T	possibly damaging	Het
Zbtb5	T	C	4: 44,995,244	T47A	probably damaging	Het
Zcchc14	T	C	8: 121,605,245	T460A	not run	Het
Zfp712	A	C	13: 67,052,419		probably null	Het
Zfyve16	A	T	13: 92,522,328	H358Q	probably benign	Het

Other mutations in Crisp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00974:Crisp4	APN	1	18128647	missense	probably damaging	1.00
IGL01071:Crisp4	APN	1	18137007	missense	probably benign	0.41
IGL01641:Crisp4	APN	1	18124290	missense	possibly damaging	0.91
IGL01670:Crisp4	APN	1	18128677	missense	probably benign	0.03
IGL01985:Crisp4	APN	1	18134065	missense	probably damaging	1.00
IGL02043:Crisp4	APN	1	18134100	missense	probably damaging	1.00
R1241:Crisp4	UTSW	1	18122794	missense	probably damaging	1.00
R1978:Crisp4	UTSW	1	18128665	missense	probably benign	0.04
R5269:Crisp4	UTSW	1	18128710	missense	probably damaging	1.00
R5736:Crisp4	UTSW	1	18115715	missense	probably benign	0.03
R6154:Crisp4	UTSW	1	18122788	missense	possibly damaging	0.80
R6999:Crisp4	UTSW	1	18137035	missense	possibly damaging	0.56
R7255:Crisp4	UTSW	1	18130231	missense	probably damaging	0.99
R7446:Crisp4	UTSW	1	18122738	missense	probably damaging	1.00
R7800:Crisp4	UTSW	1	18128749	missense	probably benign	0.02
R7881:Crisp4	UTSW	1	18128669	missense	probably benign	0.07
R8053:Crisp4	UTSW	1	18124274	missense	probably benign	0.19
R8881:Crisp4	UTSW	1	18115678	missense	probably damaging	0.96
R8885:Crisp4	UTSW	1	18136924	intron	probably benign
R9188:Crisp4	UTSW	1	18122766	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATTTTCCTTAGGCCTGAGAAGAG -3'
(R):5'- GCCAGACTTGAGCACAACATG -3'

Sequencing Primer
(F):5'- ACTGACACATATATCCAGTCATGTG -3'
(R):5'- GAGCACAACATGATCATTCAGTG -3'

Posted On

2019-12-20