Incidental Mutation 'R7831:Crisp4'
ID605585
Institutional Source Beutler Lab
Gene Symbol Crisp4
Ensembl Gene ENSMUSG00000025774
Gene Namecysteine-rich secretory protein 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7831 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location18115191-18145902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18128789 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 140 (N140K)
Ref Sequence ENSEMBL: ENSMUSP00000111001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026876] [ENSMUST00000115340] [ENSMUST00000115344]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026876
AA Change: N101K

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026876
Gene: ENSMUSG00000025774
AA Change: N101K

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
SCP 44 188 1.32e-45 SMART
Pfam:Crisp 200 254 4.8e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115340
AA Change: N97K

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110997
Gene: ENSMUSG00000025774
AA Change: N97K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCP 40 184 1.32e-45 SMART
Pfam:Crisp 196 250 6.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115344
AA Change: N140K

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111001
Gene: ENSMUSG00000025774
AA Change: N140K

DomainStartEndE-ValueType
transmembrane domain 39 61 N/A INTRINSIC
SCP 83 227 1.32e-45 SMART
Pfam:Crisp 239 293 1.6e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fertilization consists of a sequence of specific cell-cell interactions culminating in the fusion of the sperm and egg plasma membranes. Recognition, binding, and fusion occur through the interaction of complementary molecules that are localized to specific domains of the sperm and egg plasma membranes. In the sperm, the postacrosomal region or equatorial segment is involved in sperm-egg plasma membrane fusion. The protein encoded by this gene is a member of the cysteine-rich secretory protein (CRISP) family. It is expressed in the epididymis, is secreted into the epididymal lumen, and binds to the postacrosomal region of the sperm head, where it plays a role in sperm-egg fusion. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a null mutation display an impaired acrosome reaction in response to progesterone but are fertile with normal testis morphology and weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,297,404 V2384I possibly damaging Het
Acsl1 A G 8: 46,519,006 D297G probably benign Het
Ap2a1 C A 7: 44,901,012 R944L probably damaging Het
Apbb1ip A G 2: 22,866,921 Y398C probably damaging Het
Atp8a2 A T 14: 59,773,753 V968D probably damaging Het
Becn1 T C 11: 101,290,453 T341A probably benign Het
Card11 G T 5: 140,873,412 S1126R possibly damaging Het
Ccdc51 T C 9: 109,091,990 L315S probably damaging Het
Cdk12 T C 11: 98,249,827 L1298P unknown Het
Cep170b A T 12: 112,744,800 D1538V probably benign Het
Cfap52 A T 11: 67,935,956 F348I possibly damaging Het
Clip1 A T 5: 123,613,279 M813K Het
Col19a1 G A 1: 24,526,482 T256I unknown Het
Col6a3 A T 1: 90,796,546 C2027* probably null Het
Crocc2 G T 1: 93,215,473 A1266S probably benign Het
Cyfip2 G A 11: 46,196,446 R1206C probably damaging Het
Cyp24a1 T A 2: 170,485,940 M461L probably damaging Het
Cyp2a5 C T 7: 26,835,515 T51I possibly damaging Het
Cyp2b19 C T 7: 26,767,140 H398Y possibly damaging Het
Cyp4a29 G A 4: 115,250,170 V234I probably benign Het
Dicer1 T G 12: 104,708,800 K734N probably damaging Het
Dnaic1 T C 4: 41,614,695 probably null Het
Entpd3 G A 9: 120,543,959 G14D probably damaging Het
Ermp1 T C 19: 29,617,967 T634A probably benign Het
Evc C T 5: 37,319,083 G374D probably damaging Het
Fam189b G A 3: 89,184,213 probably null Het
Fcgbp C A 7: 28,106,979 T2124K probably damaging Het
Fgf8 G A 19: 45,742,437 P50S probably benign Het
Fmnl1 C T 11: 103,198,173 R1074W unknown Het
Galnt18 C T 7: 111,556,458 V223M possibly damaging Het
Galnt2 A G 8: 124,332,078 N295S probably benign Het
Gm9573 T A 17: 35,618,759 T1512S unknown Het
Grip1 T G 10: 120,018,106 V600G probably damaging Het
Insm2 T A 12: 55,600,538 C356S probably damaging Het
Itpr2 T A 6: 146,291,584 I1672F probably benign Het
Kdm1b T G 13: 47,050,622 N76K probably benign Het
Khnyn T A 14: 55,887,846 probably null Het
Kidins220 C T 12: 25,061,231 A1167V possibly damaging Het
Krt40 T C 11: 99,541,261 D208G probably benign Het
Lars T A 18: 42,217,562 D894V probably benign Het
Lmx1a A T 1: 167,840,952 N266I probably benign Het
Mrgprb5 T A 7: 48,168,249 K246M probably benign Het
Mrpl2 G A 17: 46,648,672 G176R possibly damaging Het
Nell1 T A 7: 49,982,800 F60L possibly damaging Het
Nnt G A 13: 119,370,094 A453V possibly damaging Het
Olfr366 C T 2: 37,219,711 T74I probably damaging Het
Olfr398 A C 11: 73,984,431 M59R probably damaging Het
Olfr697 T A 7: 106,741,413 I174F probably damaging Het
Opa1 A G 16: 29,648,937 K940R probably benign Het
Opn5 A C 17: 42,580,619 I309S probably null Het
P3h3 T G 6: 124,855,155 E256A possibly damaging Het
Pald1 G T 10: 61,355,814 T65K probably damaging Het
Pcnx3 T C 19: 5,685,961 Y279C probably damaging Het
Pik3c2b G A 1: 133,071,242 S367N possibly damaging Het
Pik3cb T C 9: 99,088,613 T342A probably benign Het
Pkd1l3 A T 8: 109,631,358 E837D possibly damaging Het
Ppp2r2b T A 18: 42,701,532 Y191F probably benign Het
Ppp4r4 G A 12: 103,590,821 E439K possibly damaging Het
Pqlc3 T A 12: 16,997,631 probably null Het
Ptprk A G 10: 28,568,408 I946V possibly damaging Het
Ror1 A G 4: 100,441,098 N556S probably benign Het
Ryr3 C T 2: 112,926,838 A391T possibly damaging Het
Selp G A 1: 164,145,015 probably null Het
Setx T C 2: 29,157,108 L1866S probably damaging Het
Setx T A 2: 29,179,854 V2557E possibly damaging Het
Slit2 A G 5: 48,244,683 T805A probably benign Het
Sorbs3 T G 14: 70,203,032 N89T possibly damaging Het
Sorl1 C A 9: 42,089,961 V248L probably benign Het
Srebf2 T A 15: 82,182,087 V612E probably damaging Het
Sv2c T A 13: 95,976,692 Y583F probably damaging Het
Tada1 G T 1: 166,389,873 R193I probably damaging Het
Tnrc6b C G 15: 80,880,379 A694G possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn C T 2: 76,881,081 G8372D unknown Het
Ube2g2 A G 10: 77,634,742 T68A Het
Ubl7 T G 9: 57,914,635 V89G possibly damaging Het
Ush2a T A 1: 188,759,841 I3109N probably damaging Het
Utp20 T A 10: 88,762,770 K115* probably null Het
Vmn2r26 T A 6: 124,039,799 Y407* probably null Het
Yod1 G T 1: 130,719,249 V288F probably damaging Het
Zbed5 A C 5: 129,901,957 N249T possibly damaging Het
Zbtb5 T C 4: 44,995,244 T47A probably damaging Het
Zcchc14 T C 8: 121,605,245 T460A not run Het
Zfp712 A C 13: 67,052,419 probably null Het
Zfyve16 A T 13: 92,522,328 H358Q probably benign Het
Other mutations in Crisp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Crisp4 APN 1 18128647 missense probably damaging 1.00
IGL01071:Crisp4 APN 1 18137007 missense probably benign 0.41
IGL01641:Crisp4 APN 1 18124290 missense possibly damaging 0.91
IGL01670:Crisp4 APN 1 18128677 missense probably benign 0.03
IGL01985:Crisp4 APN 1 18134065 missense probably damaging 1.00
IGL02043:Crisp4 APN 1 18134100 missense probably damaging 1.00
R1241:Crisp4 UTSW 1 18122794 missense probably damaging 1.00
R1978:Crisp4 UTSW 1 18128665 missense probably benign 0.04
R5269:Crisp4 UTSW 1 18128710 missense probably damaging 1.00
R5736:Crisp4 UTSW 1 18115715 missense probably benign 0.03
R6154:Crisp4 UTSW 1 18122788 missense possibly damaging 0.80
R6999:Crisp4 UTSW 1 18137035 missense possibly damaging 0.56
R7255:Crisp4 UTSW 1 18130231 missense probably damaging 0.99
R7446:Crisp4 UTSW 1 18122738 missense probably damaging 1.00
R7800:Crisp4 UTSW 1 18128749 missense probably benign 0.02
R7881:Crisp4 UTSW 1 18128669 missense probably benign 0.07
R8053:Crisp4 UTSW 1 18124274 missense probably benign 0.19
R8881:Crisp4 UTSW 1 18115678 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATTTTCCTTAGGCCTGAGAAGAG -3'
(R):5'- GCCAGACTTGAGCACAACATG -3'

Sequencing Primer
(F):5'- ACTGACACATATATCCAGTCATGTG -3'
(R):5'- GAGCACAACATGATCATTCAGTG -3'
Posted On2019-12-20