Incidental Mutation 'R7831:Cyp2b19'
ID 605618
Institutional Source Beutler Lab
Gene Symbol Cyp2b19
Ensembl Gene ENSMUSG00000066704
Gene Name cytochrome P450, family 2, subfamily b, polypeptide 19
Synonyms
MMRRC Submission 045885-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R7831 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 26456567-26472055 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 26466565 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 398 (H398Y)
Ref Sequence ENSEMBL: ENSMUSP00000077021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077855]
AlphaFold O55071
Predicted Effect possibly damaging
Transcript: ENSMUST00000077855
AA Change: H398Y

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077021
Gene: ENSMUSG00000066704
AA Change: H398Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:p450 32 489 8.7e-151 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (87/87)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,247,404 (GRCm39) V2384I possibly damaging Het
Acsl1 A G 8: 46,972,043 (GRCm39) D297G probably benign Het
Ap2a1 C A 7: 44,550,436 (GRCm39) R944L probably damaging Het
Apbb1ip A G 2: 22,756,933 (GRCm39) Y398C probably damaging Het
Atp8a2 A T 14: 60,011,202 (GRCm39) V968D probably damaging Het
Becn1 T C 11: 101,181,279 (GRCm39) T341A probably benign Het
Card11 G T 5: 140,859,167 (GRCm39) S1126R possibly damaging Het
Ccdc51 T C 9: 108,921,058 (GRCm39) L315S probably damaging Het
Cdk12 T C 11: 98,140,653 (GRCm39) L1298P unknown Het
Cep170b A T 12: 112,711,234 (GRCm39) D1538V probably benign Het
Cfap52 A T 11: 67,826,782 (GRCm39) F348I possibly damaging Het
Clip1 A T 5: 123,751,342 (GRCm39) M813K Het
Col19a1 G A 1: 24,565,563 (GRCm39) T256I unknown Het
Col6a3 A T 1: 90,724,268 (GRCm39) C2027* probably null Het
Crisp4 A T 1: 18,199,013 (GRCm39) N140K probably benign Het
Crocc2 G T 1: 93,143,195 (GRCm39) A1266S probably benign Het
Cyfip2 G A 11: 46,087,273 (GRCm39) R1206C probably damaging Het
Cyp24a1 T A 2: 170,327,860 (GRCm39) M461L probably damaging Het
Cyp2a5 C T 7: 26,534,940 (GRCm39) T51I possibly damaging Het
Cyp4a29 G A 4: 115,107,367 (GRCm39) V234I probably benign Het
Dicer1 T G 12: 104,675,059 (GRCm39) K734N probably damaging Het
Dnai1 T C 4: 41,614,695 (GRCm39) probably null Het
Entpd3 G A 9: 120,373,025 (GRCm39) G14D probably damaging Het
Entrep3 G A 3: 89,091,520 (GRCm39) probably null Het
Ermp1 T C 19: 29,595,367 (GRCm39) T634A probably benign Het
Evc C T 5: 37,476,427 (GRCm39) G374D probably damaging Het
Fcgbp C A 7: 27,806,404 (GRCm39) T2124K probably damaging Het
Fgf8 G A 19: 45,730,876 (GRCm39) P50S probably benign Het
Fmnl1 C T 11: 103,088,999 (GRCm39) R1074W unknown Het
Galnt18 C T 7: 111,155,665 (GRCm39) V223M possibly damaging Het
Galnt2 A G 8: 125,058,817 (GRCm39) N295S probably benign Het
Grip1 T G 10: 119,854,011 (GRCm39) V600G probably damaging Het
Insm2 T A 12: 55,647,323 (GRCm39) C356S probably damaging Het
Itpr2 T A 6: 146,193,082 (GRCm39) I1672F probably benign Het
Kdm1b T G 13: 47,204,098 (GRCm39) N76K probably benign Het
Khnyn T A 14: 56,125,303 (GRCm39) probably null Het
Kidins220 C T 12: 25,111,230 (GRCm39) A1167V possibly damaging Het
Krt40 T C 11: 99,432,087 (GRCm39) D208G probably benign Het
Lars1 T A 18: 42,350,627 (GRCm39) D894V probably benign Het
Lmx1a A T 1: 167,668,521 (GRCm39) N266I probably benign Het
Mrgprb5 T A 7: 47,817,997 (GRCm39) K246M probably benign Het
Mrpl2 G A 17: 46,959,598 (GRCm39) G176R possibly damaging Het
Muc21 T A 17: 35,929,651 (GRCm39) T1512S unknown Het
Nell1 T A 7: 49,632,548 (GRCm39) F60L possibly damaging Het
Nnt G A 13: 119,506,630 (GRCm39) A453V possibly damaging Het
Opa1 A G 16: 29,467,755 (GRCm39) K940R probably benign Het
Opn5 A C 17: 42,891,510 (GRCm39) I309S probably null Het
Or1af1 C T 2: 37,109,723 (GRCm39) T74I probably damaging Het
Or1r1 A C 11: 73,875,257 (GRCm39) M59R probably damaging Het
Or2ag15 T A 7: 106,340,620 (GRCm39) I174F probably damaging Het
P3h3 T G 6: 124,832,118 (GRCm39) E256A possibly damaging Het
Pald1 G T 10: 61,191,593 (GRCm39) T65K probably damaging Het
Pcnx3 T C 19: 5,735,989 (GRCm39) Y279C probably damaging Het
Pik3c2b G A 1: 132,998,980 (GRCm39) S367N possibly damaging Het
Pik3cb T C 9: 98,970,666 (GRCm39) T342A probably benign Het
Pkd1l3 A T 8: 110,357,990 (GRCm39) E837D possibly damaging Het
Ppp2r2b T A 18: 42,834,597 (GRCm39) Y191F probably benign Het
Ppp4r4 G A 12: 103,557,080 (GRCm39) E439K possibly damaging Het
Ptprk A G 10: 28,444,404 (GRCm39) I946V possibly damaging Het
Ror1 A G 4: 100,298,295 (GRCm39) N556S probably benign Het
Ryr3 C T 2: 112,757,183 (GRCm39) A391T possibly damaging Het
Selp G A 1: 163,972,584 (GRCm39) probably null Het
Setx T C 2: 29,047,120 (GRCm39) L1866S probably damaging Het
Setx T A 2: 29,069,866 (GRCm39) V2557E possibly damaging Het
Slc66a3 T A 12: 17,047,632 (GRCm39) probably null Het
Slit2 A G 5: 48,402,025 (GRCm39) T805A probably benign Het
Sorbs3 T G 14: 70,440,481 (GRCm39) N89T possibly damaging Het
Sorl1 C A 9: 42,001,257 (GRCm39) V248L probably benign Het
Srebf2 T A 15: 82,066,288 (GRCm39) V612E probably damaging Het
Sv2c T A 13: 96,113,200 (GRCm39) Y583F probably damaging Het
Tada1 G T 1: 166,217,442 (GRCm39) R193I probably damaging Het
Tnrc6b C G 15: 80,764,580 (GRCm39) A694G possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Ttn C T 2: 76,711,425 (GRCm39) G8372D unknown Het
Ube2g2 A G 10: 77,470,576 (GRCm39) T68A Het
Ubl7 T G 9: 57,821,918 (GRCm39) V89G possibly damaging Het
Ush2a T A 1: 188,492,038 (GRCm39) I3109N probably damaging Het
Utp20 T A 10: 88,598,632 (GRCm39) K115* probably null Het
Vmn2r26 T A 6: 124,016,758 (GRCm39) Y407* probably null Het
Yod1 G T 1: 130,646,986 (GRCm39) V288F probably damaging Het
Zbed5 A C 5: 129,930,798 (GRCm39) N249T possibly damaging Het
Zbtb5 T C 4: 44,995,244 (GRCm39) T47A probably damaging Het
Zcchc14 T C 8: 122,331,984 (GRCm39) T460A not run Het
Zfp712 A C 13: 67,200,483 (GRCm39) probably null Het
Zfyve16 A T 13: 92,658,836 (GRCm39) H358Q probably benign Het
Other mutations in Cyp2b19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Cyp2b19 APN 7 26,462,886 (GRCm39) missense possibly damaging 0.91
IGL01338:Cyp2b19 APN 7 26,458,842 (GRCm39) missense probably benign 0.09
IGL01374:Cyp2b19 APN 7 26,458,504 (GRCm39) missense probably benign 0.06
IGL01613:Cyp2b19 APN 7 26,462,886 (GRCm39) missense possibly damaging 0.91
IGL01695:Cyp2b19 APN 7 26,458,489 (GRCm39) missense probably damaging 1.00
IGL02322:Cyp2b19 APN 7 26,461,803 (GRCm39) missense possibly damaging 0.79
IGL03077:Cyp2b19 APN 7 26,461,809 (GRCm39) missense probably benign
R0047:Cyp2b19 UTSW 7 26,466,251 (GRCm39) missense probably benign 0.01
R0047:Cyp2b19 UTSW 7 26,466,251 (GRCm39) missense probably benign 0.01
R0452:Cyp2b19 UTSW 7 26,466,187 (GRCm39) missense probably benign 0.01
R0865:Cyp2b19 UTSW 7 26,461,654 (GRCm39) splice site probably benign
R1514:Cyp2b19 UTSW 7 26,466,585 (GRCm39) missense probably benign 0.00
R1681:Cyp2b19 UTSW 7 26,462,765 (GRCm39) splice site probably null
R2362:Cyp2b19 UTSW 7 26,463,802 (GRCm39) missense probably damaging 1.00
R4015:Cyp2b19 UTSW 7 26,461,768 (GRCm39) missense probably damaging 1.00
R4259:Cyp2b19 UTSW 7 26,462,807 (GRCm39) missense probably damaging 1.00
R4592:Cyp2b19 UTSW 7 26,470,819 (GRCm39) missense probably benign 0.04
R4705:Cyp2b19 UTSW 7 26,456,717 (GRCm39) missense probably benign 0.03
R4789:Cyp2b19 UTSW 7 26,463,801 (GRCm39) missense probably benign 0.16
R5481:Cyp2b19 UTSW 7 26,466,246 (GRCm39) missense probably damaging 0.99
R5749:Cyp2b19 UTSW 7 26,462,844 (GRCm39) missense possibly damaging 0.84
R6041:Cyp2b19 UTSW 7 26,458,852 (GRCm39) missense probably damaging 1.00
R6170:Cyp2b19 UTSW 7 26,458,519 (GRCm39) missense possibly damaging 0.80
R6259:Cyp2b19 UTSW 7 26,470,817 (GRCm39) missense possibly damaging 0.91
R6370:Cyp2b19 UTSW 7 26,462,783 (GRCm39) missense probably benign 0.07
R6519:Cyp2b19 UTSW 7 26,458,536 (GRCm39) missense probably benign
R6656:Cyp2b19 UTSW 7 26,466,280 (GRCm39) missense probably benign
R7283:Cyp2b19 UTSW 7 26,466,339 (GRCm39) missense probably damaging 1.00
R7583:Cyp2b19 UTSW 7 26,458,489 (GRCm39) missense probably damaging 1.00
R7686:Cyp2b19 UTSW 7 26,461,768 (GRCm39) missense probably damaging 1.00
R7732:Cyp2b19 UTSW 7 26,470,769 (GRCm39) missense possibly damaging 0.67
R8035:Cyp2b19 UTSW 7 26,470,675 (GRCm39) missense probably damaging 1.00
R8853:Cyp2b19 UTSW 7 26,456,645 (GRCm39) missense possibly damaging 0.53
R9574:Cyp2b19 UTSW 7 26,466,353 (GRCm39) missense probably null 1.00
R9574:Cyp2b19 UTSW 7 26,466,352 (GRCm39) missense probably damaging 1.00
R9650:Cyp2b19 UTSW 7 26,466,208 (GRCm39) missense possibly damaging 0.85
R9681:Cyp2b19 UTSW 7 26,466,328 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGATCAGCTGCCATTCCTC -3'
(R):5'- AGTGAACAGGACCCTATTGC -3'

Sequencing Primer
(F):5'- GATCAGCTGCCATTCCTCATTGC -3'
(R):5'- ACAGGACCCTATTGCTGTTTG -3'
Posted On 2019-12-20