Mutagenetix > Incidental Mutation

Incidental Mutation 'R7831:Sorl1'

605630

Institutional Source

Beutler Lab

Gene Symbol

Sorl1

Ensembl Gene

ENSMUSG00000049313

Gene Name

sortilin-related receptor, LDLR class A repeats-containing

Synonyms

2900010L19Rik, mSorLA, Sorla, LR11

MMRRC Submission

Accession Numbers

Genbank: NM_011436; MGI: 1202296

Essential gene?

Probably non essential (E-score: 0.213) question?

Stock #

R7831 (G1)

Quality Score

188.009

Status

Validated

Chromosome

Chromosomal Location

41964720-42124297 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 42089961 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 248 (V248L)

Ref Sequence

ENSEMBL: ENSMUSP00000058613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060989]

AlphaFold

O88307

Predicted Effect

probably benign
Transcript: ENSMUST00000060989
AA Change: V248L

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: V248L

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
VPS10	124	757	N/A	SMART
LY	780	822	9.33e-6	SMART
LY	824	866	2.38e-12	SMART
LY	867	912	1.87e-5	SMART
LY	913	953	1.08e-10	SMART
LY	954	993	5.43e0	SMART
EGF_like	1020	1072	2.8e1	SMART
LDLa	1077	1114	1.76e-14	SMART
LDLa	1116	1155	5.34e-14	SMART
LDLa	1157	1194	1.67e-15	SMART
EGF_like	1198	1236	4.93e1	SMART
LDLa	1198	1237	3.83e-15	SMART
LDLa	1238	1273	1.99e-13	SMART
LDLa	1274	1317	2.53e-6	SMART
LDLa	1324	1361	4.34e-14	SMART
LDLa	1367	1405	1.14e-13	SMART
LDLa	1418	1455	3.34e-15	SMART
LDLa	1470	1508	1.09e-10	SMART
LDLa	1513	1551	1.09e-10	SMART
FN3	1555	1638	4.19e-4	SMART
FN3	1651	1732	7.23e-8	SMART
FN3	1747	1830	4.8e0	SMART
FN3	1842	1920	3e1	SMART
FN3	1933	2016	6.01e-5	SMART
FN3	2025	2107	2.03e-2	SMART
transmembrane domain	2137	2159	N/A	INTRINSIC
low complexity region	2188	2199	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (87/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]

Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	G	A	11: 9,297,404	V2384I	possibly damaging	Het
Acsl1	A	G	8: 46,519,006	D297G	probably benign	Het
Ap2a1	C	A	7: 44,901,012	R944L	probably damaging	Het
Apbb1ip	A	G	2: 22,866,921	Y398C	probably damaging	Het
Atp8a2	A	T	14: 59,773,753	V968D	probably damaging	Het
Becn1	T	C	11: 101,290,453	T341A	probably benign	Het
Card11	G	T	5: 140,873,412	S1126R	possibly damaging	Het
Ccdc51	T	C	9: 109,091,990	L315S	probably damaging	Het
Cdk12	T	C	11: 98,249,827	L1298P	unknown	Het
Cep170b	A	T	12: 112,744,800	D1538V	probably benign	Het
Cfap52	A	T	11: 67,935,956	F348I	possibly damaging	Het
Clip1	A	T	5: 123,613,279	M813K		Het
Col19a1	G	A	1: 24,526,482	T256I	unknown	Het
Col6a3	A	T	1: 90,796,546	C2027*	probably null	Het
Crisp4	A	T	1: 18,128,789	N140K	probably benign	Het
Crocc2	G	T	1: 93,215,473	A1266S	probably benign	Het
Cyfip2	G	A	11: 46,196,446	R1206C	probably damaging	Het
Cyp24a1	T	A	2: 170,485,940	M461L	probably damaging	Het
Cyp2a5	C	T	7: 26,835,515	T51I	possibly damaging	Het
Cyp2b19	C	T	7: 26,767,140	H398Y	possibly damaging	Het
Cyp4a29	G	A	4: 115,250,170	V234I	probably benign	Het
Dicer1	T	G	12: 104,708,800	K734N	probably damaging	Het
Dnaic1	T	C	4: 41,614,695		probably null	Het
Entpd3	G	A	9: 120,543,959	G14D	probably damaging	Het
Ermp1	T	C	19: 29,617,967	T634A	probably benign	Het
Evc	C	T	5: 37,319,083	G374D	probably damaging	Het
Fam189b	G	A	3: 89,184,213		probably null	Het
Fcgbp	C	A	7: 28,106,979	T2124K	probably damaging	Het
Fgf8	G	A	19: 45,742,437	P50S	probably benign	Het
Fmnl1	C	T	11: 103,198,173	R1074W	unknown	Het
Galnt18	C	T	7: 111,556,458	V223M	possibly damaging	Het
Galnt2	A	G	8: 124,332,078	N295S	probably benign	Het
Gm9573	T	A	17: 35,618,759	T1512S	unknown	Het
Grip1	T	G	10: 120,018,106	V600G	probably damaging	Het
Insm2	T	A	12: 55,600,538	C356S	probably damaging	Het
Itpr2	T	A	6: 146,291,584	I1672F	probably benign	Het
Kdm1b	T	G	13: 47,050,622	N76K	probably benign	Het
Khnyn	T	A	14: 55,887,846		probably null	Het
Kidins220	C	T	12: 25,061,231	A1167V	possibly damaging	Het
Krt40	T	C	11: 99,541,261	D208G	probably benign	Het
Lars	T	A	18: 42,217,562	D894V	probably benign	Het
Lmx1a	A	T	1: 167,840,952	N266I	probably benign	Het
Mrgprb5	T	A	7: 48,168,249	K246M	probably benign	Het
Mrpl2	G	A	17: 46,648,672	G176R	possibly damaging	Het
Nell1	T	A	7: 49,982,800	F60L	possibly damaging	Het
Nnt	G	A	13: 119,370,094	A453V	possibly damaging	Het
Olfr366	C	T	2: 37,219,711	T74I	probably damaging	Het
Olfr398	A	C	11: 73,984,431	M59R	probably damaging	Het
Olfr697	T	A	7: 106,741,413	I174F	probably damaging	Het
Opa1	A	G	16: 29,648,937	K940R	probably benign	Het
Opn5	A	C	17: 42,580,619	I309S	probably null	Het
P3h3	T	G	6: 124,855,155	E256A	possibly damaging	Het
Pald1	G	T	10: 61,355,814	T65K	probably damaging	Het
Pcnx3	T	C	19: 5,685,961	Y279C	probably damaging	Het
Pik3c2b	G	A	1: 133,071,242	S367N	possibly damaging	Het
Pik3cb	T	C	9: 99,088,613	T342A	probably benign	Het
Pkd1l3	A	T	8: 109,631,358	E837D	possibly damaging	Het
Ppp2r2b	T	A	18: 42,701,532	Y191F	probably benign	Het
Ppp4r4	G	A	12: 103,590,821	E439K	possibly damaging	Het
Pqlc3	T	A	12: 16,997,631		probably null	Het
Ptprk	A	G	10: 28,568,408	I946V	possibly damaging	Het
Ror1	A	G	4: 100,441,098	N556S	probably benign	Het
Ryr3	C	T	2: 112,926,838	A391T	possibly damaging	Het
Selp	G	A	1: 164,145,015		probably null	Het
Setx	T	C	2: 29,157,108	L1866S	probably damaging	Het
Setx	T	A	2: 29,179,854	V2557E	possibly damaging	Het
Slit2	A	G	5: 48,244,683	T805A	probably benign	Het
Sorbs3	T	G	14: 70,203,032	N89T	possibly damaging	Het
Srebf2	T	A	15: 82,182,087	V612E	probably damaging	Het
Sv2c	T	A	13: 95,976,692	Y583F	probably damaging	Het
Tada1	G	T	1: 166,389,873	R193I	probably damaging	Het
Tnrc6b	C	G	15: 80,880,379	A694G	possibly damaging	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Ttn	C	T	2: 76,881,081	G8372D	unknown	Het
Ube2g2	A	G	10: 77,634,742	T68A		Het
Ubl7	T	G	9: 57,914,635	V89G	possibly damaging	Het
Ush2a	T	A	1: 188,759,841	I3109N	probably damaging	Het
Utp20	T	A	10: 88,762,770	K115*	probably null	Het
Vmn2r26	T	A	6: 124,039,799	Y407*	probably null	Het
Yod1	G	T	1: 130,719,249	V288F	probably damaging	Het
Zbed5	A	C	5: 129,901,957	N249T	possibly damaging	Het
Zbtb5	T	C	4: 44,995,244	T47A	probably damaging	Het
Zcchc14	T	C	8: 121,605,245	T460A	not run	Het
Zfp712	A	C	13: 67,052,419		probably null	Het
Zfyve16	A	T	13: 92,522,328	H358Q	probably benign	Het

Other mutations in Sorl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Sorl1	APN	9	41974094	missense	probably damaging	1.00
IGL01303:Sorl1	APN	9	42024478	splice site	probably benign
IGL01545:Sorl1	APN	9	42043956	missense	probably damaging	1.00
IGL01629:Sorl1	APN	9	42057269	critical splice donor site	probably null
IGL01670:Sorl1	APN	9	42001492	missense	possibly damaging	0.81
IGL01684:Sorl1	APN	9	41980711	missense	probably damaging	0.96
IGL02154:Sorl1	APN	9	42004034	missense	probably benign
IGL02215:Sorl1	APN	9	42018182	missense	probably damaging	0.97
IGL02427:Sorl1	APN	9	42041690	missense	probably damaging	1.00
IGL02590:Sorl1	APN	9	42046561	missense	probably benign	0.01
IGL02794:Sorl1	APN	9	42063774	missense	probably damaging	0.98
IGL02797:Sorl1	APN	9	42037059	missense	probably damaging	0.99
IGL02987:Sorl1	APN	9	42041053	missense	probably damaging	1.00
IGL03005:Sorl1	APN	9	42057325	missense	probably damaging	1.00
IGL03069:Sorl1	APN	9	41991426	missense	probably benign
IGL03288:Sorl1	APN	9	42033562	splice site	probably benign
N/A - 287:Sorl1	UTSW	9	42041596	nonsense	probably null
PIT4151001:Sorl1	UTSW	9	41968622	missense	probably damaging	1.00
R0117:Sorl1	UTSW	9	42033577	missense	probably benign	0.10
R0173:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R0318:Sorl1	UTSW	9	42081954	missense	probably damaging	1.00
R0385:Sorl1	UTSW	9	42031909	missense	probably damaging	0.99
R0448:Sorl1	UTSW	9	42004088	missense	probably damaging	1.00
R0492:Sorl1	UTSW	9	41991371	missense	probably null	0.00
R0512:Sorl1	UTSW	9	42067832	missense	probably benign	0.01
R0587:Sorl1	UTSW	9	41984506	missense	probably damaging	1.00
R0600:Sorl1	UTSW	9	42043900	splice site	probably benign
R0831:Sorl1	UTSW	9	42071069	splice site	probably benign
R0924:Sorl1	UTSW	9	42008174	splice site	probably benign
R1013:Sorl1	UTSW	9	42002559	missense	probably benign	0.00
R1053:Sorl1	UTSW	9	41991456	missense	probably benign
R1077:Sorl1	UTSW	9	42014490	missense	probably damaging	1.00
R1326:Sorl1	UTSW	9	42031796	missense	probably benign	0.14
R1348:Sorl1	UTSW	9	42000412	splice site	probably null
R1498:Sorl1	UTSW	9	42041073	missense	probably damaging	1.00
R1671:Sorl1	UTSW	9	41974000	missense	probably damaging	1.00
R1713:Sorl1	UTSW	9	41996242	missense	probably benign	0.06
R1738:Sorl1	UTSW	9	42089965	missense	probably benign	0.33
R1779:Sorl1	UTSW	9	41991482	critical splice acceptor site	probably null
R1871:Sorl1	UTSW	9	41969725	nonsense	probably null
R1912:Sorl1	UTSW	9	42081950	missense	probably damaging	1.00
R1952:Sorl1	UTSW	9	42046624	missense	probably benign
R2071:Sorl1	UTSW	9	41979457	missense	possibly damaging	0.71
R2153:Sorl1	UTSW	9	41984492	missense	probably benign	0.01
R2417:Sorl1	UTSW	9	41980711	missense	probably damaging	0.96
R2429:Sorl1	UTSW	9	42037070	missense	probably damaging	1.00
R2866:Sorl1	UTSW	9	41969781	missense	probably benign
R3815:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3816:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3817:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3819:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3890:Sorl1	UTSW	9	42004105	missense	probably damaging	1.00
R3941:Sorl1	UTSW	9	41989468	critical splice acceptor site	probably null
R4409:Sorl1	UTSW	9	42035448	missense	probably damaging	0.99
R4410:Sorl1	UTSW	9	42003992	nonsense	probably null
R4610:Sorl1	UTSW	9	42031914	missense	possibly damaging	0.65
R4664:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4666:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4668:Sorl1	UTSW	9	41984508	missense	probably damaging	1.00
R4823:Sorl1	UTSW	9	41992321	missense	probably damaging	1.00
R4874:Sorl1	UTSW	9	42063752	missense	probably damaging	0.99
R4898:Sorl1	UTSW	9	42041639	missense	probably damaging	1.00
R4922:Sorl1	UTSW	9	42014450	splice site	probably null
R4976:Sorl1	UTSW	9	41983003	missense	probably benign	0.00
R4984:Sorl1	UTSW	9	41991342	missense	probably damaging	1.00
R5046:Sorl1	UTSW	9	41996294	missense	probably benign
R5070:Sorl1	UTSW	9	42031818	missense	possibly damaging	0.82
R5084:Sorl1	UTSW	9	41976377	missense	probably benign	0.01
R5202:Sorl1	UTSW	9	42033583	missense	probably benign	0.00
R5265:Sorl1	UTSW	9	42106516	missense	possibly damaging	0.80
R5275:Sorl1	UTSW	9	42030902	missense	probably benign	0.33
R5368:Sorl1	UTSW	9	41979390	missense	probably benign	0.00
R5385:Sorl1	UTSW	9	42057284	missense	possibly damaging	0.83
R5386:Sorl1	UTSW	9	42057284	missense	possibly damaging	0.83
R5416:Sorl1	UTSW	9	42002636	nonsense	probably null
R5518:Sorl1	UTSW	9	42037212	missense	possibly damaging	0.92
R5545:Sorl1	UTSW	9	41991625	missense	probably benign	0.08
R5864:Sorl1	UTSW	9	42092373	missense	probably damaging	1.00
R5865:Sorl1	UTSW	9	41983034	missense	possibly damaging	0.94
R6339:Sorl1	UTSW	9	41969742	missense	probably benign	0.10
R6484:Sorl1	UTSW	9	41976407	missense	probably damaging	1.00
R6505:Sorl1	UTSW	9	42071234	missense	probably damaging	1.00
R6591:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6596:Sorl1	UTSW	9	42001603	missense	possibly damaging	0.81
R6654:Sorl1	UTSW	9	41980645	missense	possibly damaging	0.47
R6691:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6702:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6703:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6775:Sorl1	UTSW	9	42092452	missense	possibly damaging	0.93
R6792:Sorl1	UTSW	9	42099263	missense	probably damaging	1.00
R6852:Sorl1	UTSW	9	42024398	missense	possibly damaging	0.90
R6860:Sorl1	UTSW	9	42022392	missense	probably benign	0.01
R6925:Sorl1	UTSW	9	42033626	missense	probably damaging	1.00
R7022:Sorl1	UTSW	9	41969751	missense	probably benign	0.11
R7033:Sorl1	UTSW	9	42030983	missense	possibly damaging	0.93
R7091:Sorl1	UTSW	9	42002634	missense	probably benign	0.00
R7267:Sorl1	UTSW	9	42124079	missense	possibly damaging	0.63
R7269:Sorl1	UTSW	9	42037203	missense	probably damaging	0.99
R7272:Sorl1	UTSW	9	42063710	splice site	probably null
R7537:Sorl1	UTSW	9	41980688	missense	probably benign	0.01
R7615:Sorl1	UTSW	9	41977582	missense	possibly damaging	0.91
R7636:Sorl1	UTSW	9	42092334	missense	possibly damaging	0.90
R7727:Sorl1	UTSW	9	41984526	missense	probably damaging	1.00
R7763:Sorl1	UTSW	9	42043909	missense	probably damaging	1.00
R7956:Sorl1	UTSW	9	41989359	missense	probably damaging	1.00
R7964:Sorl1	UTSW	9	41991401	missense	probably damaging	1.00
R7977:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R7987:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R8151:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R8219:Sorl1	UTSW	9	42041561	splice site	probably null
R8261:Sorl1	UTSW	9	42014481	missense	probably damaging	1.00
R8283:Sorl1	UTSW	9	42030998	missense	probably damaging	1.00
R8308:Sorl1	UTSW	9	42018160	missense	probably damaging	1.00
R8348:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8448:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8524:Sorl1	UTSW	9	41974074	missense	probably damaging	1.00
R8869:Sorl1	UTSW	9	42022426	missense	probably benign	0.01
R8898:Sorl1	UTSW	9	42000271	missense	probably damaging	1.00
R8972:Sorl1	UTSW	9	42046552	missense	probably damaging	1.00
R9012:Sorl1	UTSW	9	42071195	missense	probably damaging	1.00
R9094:Sorl1	UTSW	9	42063754	missense	possibly damaging	0.92
R9241:Sorl1	UTSW	9	41974124	nonsense	probably null
R9278:Sorl1	UTSW	9	42046561	missense	probably benign	0.01
R9288:Sorl1	UTSW	9	42041631	missense	probably damaging	1.00
R9303:Sorl1	UTSW	9	41989443	missense	probably damaging	1.00
R9330:Sorl1	UTSW	9	42067933	missense	probably damaging	1.00
R9332:Sorl1	UTSW	9	42001518	missense	probably damaging	1.00
R9468:Sorl1	UTSW	9	42124088	missense	probably benign	0.20
R9528:Sorl1	UTSW	9	42022335	critical splice donor site	probably null
R9544:Sorl1	UTSW	9	42081809	nonsense	probably null
R9563:Sorl1	UTSW	9	42046597	missense	probably damaging	1.00
R9564:Sorl1	UTSW	9	42046597	missense	probably damaging	1.00
R9588:Sorl1	UTSW	9	42081809	nonsense	probably null
R9634:Sorl1	UTSW	9	41996294	missense	probably benign
R9671:Sorl1	UTSW	9	42031781	missense	possibly damaging	0.85
R9701:Sorl1	UTSW	9	42092470	missense	probably damaging	1.00
Z1176:Sorl1	UTSW	9	42099203	missense	possibly damaging	0.64
Z1176:Sorl1	UTSW	9	42123948	missense	probably benign	0.03
Z1177:Sorl1	UTSW	9	41991638	missense	possibly damaging	0.92
Z1177:Sorl1	UTSW	9	42106541	missense	probably benign	0.00
Z1177:Sorl1	UTSW	9	42123912	missense	probably damaging	1.00
Z31818:Sorl1	UTSW	9	42041596	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTCCTCAGCATCTCAAACCG -3'
(R):5'- AAGTGGCAGGCAAGTTGTCC -3'

Sequencing Primer
(F):5'- GTCACCCTTTGATACCAGGAG -3'
(R):5'- GCCGTTCTAGAAAACAGATCTGTC -3'

Posted On

2019-12-20