Incidental Mutation 'R7831:Utp20'
ID605638
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene NameUTP20 small subunit processome component
Synonyms3830408P06Rik, DRIM, mDRIM
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R7831 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location88746607-88826804 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 88762770 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 115 (K115*)
Ref Sequence ENSEMBL: ENSMUSP00000151748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470] [ENSMUST00000218967] [ENSMUST00000220188]
Predicted Effect probably null
Transcript: ENSMUST00000004470
AA Change: K2043*
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: K2043*

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218967
AA Change: K115*
Predicted Effect probably null
Transcript: ENSMUST00000220188
AA Change: K115*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,297,404 V2384I possibly damaging Het
Acsl1 A G 8: 46,519,006 D297G probably benign Het
Ap2a1 C A 7: 44,901,012 R944L probably damaging Het
Apbb1ip A G 2: 22,866,921 Y398C probably damaging Het
Atp8a2 A T 14: 59,773,753 V968D probably damaging Het
Becn1 T C 11: 101,290,453 T341A probably benign Het
Card11 G T 5: 140,873,412 S1126R possibly damaging Het
Ccdc51 T C 9: 109,091,990 L315S probably damaging Het
Cdk12 T C 11: 98,249,827 L1298P unknown Het
Cep170b A T 12: 112,744,800 D1538V probably benign Het
Cfap52 A T 11: 67,935,956 F348I possibly damaging Het
Clip1 A T 5: 123,613,279 M813K Het
Col19a1 G A 1: 24,526,482 T256I unknown Het
Col6a3 A T 1: 90,796,546 C2027* probably null Het
Crisp4 A T 1: 18,128,789 N140K probably benign Het
Crocc2 G T 1: 93,215,473 A1266S probably benign Het
Cyfip2 G A 11: 46,196,446 R1206C probably damaging Het
Cyp24a1 T A 2: 170,485,940 M461L probably damaging Het
Cyp2a5 C T 7: 26,835,515 T51I possibly damaging Het
Cyp2b19 C T 7: 26,767,140 H398Y possibly damaging Het
Cyp4a29 G A 4: 115,250,170 V234I probably benign Het
Dicer1 T G 12: 104,708,800 K734N probably damaging Het
Dnaic1 T C 4: 41,614,695 probably null Het
Entpd3 G A 9: 120,543,959 G14D probably damaging Het
Ermp1 T C 19: 29,617,967 T634A probably benign Het
Evc C T 5: 37,319,083 G374D probably damaging Het
Fam189b G A 3: 89,184,213 probably null Het
Fcgbp C A 7: 28,106,979 T2124K probably damaging Het
Fgf8 G A 19: 45,742,437 P50S probably benign Het
Fmnl1 C T 11: 103,198,173 R1074W unknown Het
Galnt18 C T 7: 111,556,458 V223M possibly damaging Het
Galnt2 A G 8: 124,332,078 N295S probably benign Het
Gm9573 T A 17: 35,618,759 T1512S unknown Het
Grip1 T G 10: 120,018,106 V600G probably damaging Het
Insm2 T A 12: 55,600,538 C356S probably damaging Het
Itpr2 T A 6: 146,291,584 I1672F probably benign Het
Kdm1b T G 13: 47,050,622 N76K probably benign Het
Khnyn T A 14: 55,887,846 probably null Het
Kidins220 C T 12: 25,061,231 A1167V possibly damaging Het
Krt40 T C 11: 99,541,261 D208G probably benign Het
Lars T A 18: 42,217,562 D894V probably benign Het
Lmx1a A T 1: 167,840,952 N266I probably benign Het
Mrgprb5 T A 7: 48,168,249 K246M probably benign Het
Mrpl2 G A 17: 46,648,672 G176R possibly damaging Het
Nell1 T A 7: 49,982,800 F60L possibly damaging Het
Nnt G A 13: 119,370,094 A453V possibly damaging Het
Olfr366 C T 2: 37,219,711 T74I probably damaging Het
Olfr398 A C 11: 73,984,431 M59R probably damaging Het
Olfr697 T A 7: 106,741,413 I174F probably damaging Het
Opa1 A G 16: 29,648,937 K940R probably benign Het
Opn5 A C 17: 42,580,619 I309S probably null Het
P3h3 T G 6: 124,855,155 E256A possibly damaging Het
Pald1 G T 10: 61,355,814 T65K probably damaging Het
Pcnx3 T C 19: 5,685,961 Y279C probably damaging Het
Pik3c2b G A 1: 133,071,242 S367N possibly damaging Het
Pik3cb T C 9: 99,088,613 T342A probably benign Het
Pkd1l3 A T 8: 109,631,358 E837D possibly damaging Het
Ppp2r2b T A 18: 42,701,532 Y191F probably benign Het
Ppp4r4 G A 12: 103,590,821 E439K possibly damaging Het
Pqlc3 T A 12: 16,997,631 probably null Het
Ptprk A G 10: 28,568,408 I946V possibly damaging Het
Ror1 A G 4: 100,441,098 N556S probably benign Het
Ryr3 C T 2: 112,926,838 A391T possibly damaging Het
Selp G A 1: 164,145,015 probably null Het
Setx T C 2: 29,157,108 L1866S probably damaging Het
Setx T A 2: 29,179,854 V2557E possibly damaging Het
Slit2 A G 5: 48,244,683 T805A probably benign Het
Sorbs3 T G 14: 70,203,032 N89T possibly damaging Het
Sorl1 C A 9: 42,089,961 V248L probably benign Het
Srebf2 T A 15: 82,182,087 V612E probably damaging Het
Sv2c T A 13: 95,976,692 Y583F probably damaging Het
Tada1 G T 1: 166,389,873 R193I probably damaging Het
Tnrc6b C G 15: 80,880,379 A694G possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn C T 2: 76,881,081 G8372D unknown Het
Ube2g2 A G 10: 77,634,742 T68A Het
Ubl7 T G 9: 57,914,635 V89G possibly damaging Het
Ush2a T A 1: 188,759,841 I3109N probably damaging Het
Vmn2r26 T A 6: 124,039,799 Y407* probably null Het
Yod1 G T 1: 130,719,249 V288F probably damaging Het
Zbed5 A C 5: 129,901,957 N249T possibly damaging Het
Zbtb5 T C 4: 44,995,244 T47A probably damaging Het
Zcchc14 T C 8: 121,605,245 T460A not run Het
Zfp712 A C 13: 67,052,419 probably null Het
Zfyve16 A T 13: 92,522,328 H358Q probably benign Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0107:Utp20 UTSW 10 88778391 missense probably benign 0.03
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0219:Utp20 UTSW 10 88764675 missense probably damaging 1.00
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88760912 missense probably damaging 1.00
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R0616:Utp20 UTSW 10 88770751 missense probably benign 0.14
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1554:Utp20 UTSW 10 88764737 nonsense probably null
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1755:Utp20 UTSW 10 88809769 missense probably benign 0.01
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1866:Utp20 UTSW 10 88762770 nonsense probably null
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1967:Utp20 UTSW 10 88816979 missense probably benign 0.03
R2060:Utp20 UTSW 10 88774795 missense probably damaging 0.98
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2128:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2129:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3547:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4035:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88778261 missense probably damaging 1.00
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6477:Utp20 UTSW 10 88768918 missense probably benign 0.05
R6480:Utp20 UTSW 10 88755186 critical splice donor site probably null
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
R7192:Utp20 UTSW 10 88772459 missense probably benign 0.09
R7236:Utp20 UTSW 10 88749342 missense probably benign 0.28
R7260:Utp20 UTSW 10 88751472 missense probably benign 0.39
R7296:Utp20 UTSW 10 88770724 missense probably benign 0.21
R7317:Utp20 UTSW 10 88762935 missense possibly damaging 0.83
R7318:Utp20 UTSW 10 88813949 missense possibly damaging 0.89
R7330:Utp20 UTSW 10 88787562 frame shift probably null
R7367:Utp20 UTSW 10 88795443 missense probably benign 0.21
R7432:Utp20 UTSW 10 88798398 missense probably benign 0.00
R7447:Utp20 UTSW 10 88772492 missense probably damaging 1.00
R7473:Utp20 UTSW 10 88820710 splice site probably null
R7520:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R7530:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R7539:Utp20 UTSW 10 88791745 missense probably damaging 1.00
R7651:Utp20 UTSW 10 88754595 missense probably benign 0.41
R7728:Utp20 UTSW 10 88798341 missense probably damaging 1.00
R7833:Utp20 UTSW 10 88801136 missense possibly damaging 0.92
R7909:Utp20 UTSW 10 88775330 missense probably benign
R7956:Utp20 UTSW 10 88782614 missense probably benign 0.23
R7999:Utp20 UTSW 10 88770388 missense probably benign
R8080:Utp20 UTSW 10 88782715 missense possibly damaging 0.82
R8098:Utp20 UTSW 10 88752948 missense probably benign 0.13
R8104:Utp20 UTSW 10 88757904 missense probably damaging 1.00
R8129:Utp20 UTSW 10 88792625 missense probably benign 0.29
R8147:Utp20 UTSW 10 88758444 missense probably benign 0.02
R8199:Utp20 UTSW 10 88798475 missense probably benign
R8222:Utp20 UTSW 10 88778372 missense probably damaging 1.00
R8415:Utp20 UTSW 10 88826604 critical splice donor site probably null
R8466:Utp20 UTSW 10 88818503 missense probably damaging 1.00
R8505:Utp20 UTSW 10 88818008 missense probably benign 0.03
R8802:Utp20 UTSW 10 88747295 missense probably damaging 1.00
R8923:Utp20 UTSW 10 88791742 nonsense probably null
R8945:Utp20 UTSW 10 88792670 nonsense probably null
RF005:Utp20 UTSW 10 88825457 missense probably damaging 1.00
RF024:Utp20 UTSW 10 88825457 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAAGTTCTCAGCCCAAACAG -3'
(R):5'- AGAATGTCGCTCTCTGTTTGC -3'

Sequencing Primer
(F):5'- GCTATCTAAACTAGGCTGGCC -3'
(R):5'- TGCCCATTTAGATCCTACAGAATAC -3'
Posted On2019-12-20