Incidental Mutation 'R7831:Fmnl1'
ID 605647
Institutional Source Beutler Lab
Gene Symbol Fmnl1
Ensembl Gene ENSMUSG00000055805
Gene Name formin-like 1
Synonyms formin-related gene in leukocytes, 8030453N10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock # R7831 (G1)
Quality Score 214.009
Status Validated
Chromosome 11
Chromosomal Location 103171107-103198901 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 103198173 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 1074 (R1074W)
Ref Sequence ENSEMBL: ENSMUSP00000102642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021323] [ENSMUST00000042286] [ENSMUST00000107026] [ENSMUST00000107027] [ENSMUST00000129726] [ENSMUST00000172850] [ENSMUST00000174567] [ENSMUST00000218163]
AlphaFold Q9JL26
Predicted Effect probably benign
Transcript: ENSMUST00000021323
SMART Domains Protein: ENSMUSP00000021323
Gene: ENSMUSG00000020940

DomainStartEndE-ValueType
EFh 109 137 7.23e1 SMART
EFh 145 173 6.68e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042286
SMART Domains Protein: ENSMUSP00000046296
Gene: ENSMUSG00000055805

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
low complexity region 1074 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107026
SMART Domains Protein: ENSMUSP00000102641
Gene: ENSMUSG00000020940

DomainStartEndE-ValueType
EFh 40 68 7.23e1 SMART
EFh 76 104 6.68e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107027
AA Change: R1074W
SMART Domains Protein: ENSMUSP00000102642
Gene: ENSMUSG00000055805
AA Change: R1074W

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129726
SMART Domains Protein: ENSMUSP00000133299
Gene: ENSMUSG00000055805

DomainStartEndE-ValueType
Pfam:FH2 1 50 8.2e-10 PFAM
low complexity region 124 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172850
SMART Domains Protein: ENSMUSP00000139837
Gene: ENSMUSG00000020940

DomainStartEndE-ValueType
EFh 109 137 3.5e-1 SMART
EFh 145 173 3.2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174567
SMART Domains Protein: ENSMUSP00000134292
Gene: ENSMUSG00000020940

DomainStartEndE-ValueType
SCOP:d1mr8a_ 153 209 5e-8 SMART
Blast:EFh 159 187 4e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000218163
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (87/87)
MGI Phenotype PHENOTYPE: Constitutive homozygous KO is embryonic lethal. Conditional homozygous KO in myeloid cells leads to reduced macrophage migration and podosome formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,297,404 V2384I possibly damaging Het
Acsl1 A G 8: 46,519,006 D297G probably benign Het
Ap2a1 C A 7: 44,901,012 R944L probably damaging Het
Apbb1ip A G 2: 22,866,921 Y398C probably damaging Het
Atp8a2 A T 14: 59,773,753 V968D probably damaging Het
Becn1 T C 11: 101,290,453 T341A probably benign Het
Card11 G T 5: 140,873,412 S1126R possibly damaging Het
Ccdc51 T C 9: 109,091,990 L315S probably damaging Het
Cdk12 T C 11: 98,249,827 L1298P unknown Het
Cep170b A T 12: 112,744,800 D1538V probably benign Het
Cfap52 A T 11: 67,935,956 F348I possibly damaging Het
Clip1 A T 5: 123,613,279 M813K Het
Col19a1 G A 1: 24,526,482 T256I unknown Het
Col6a3 A T 1: 90,796,546 C2027* probably null Het
Crisp4 A T 1: 18,128,789 N140K probably benign Het
Crocc2 G T 1: 93,215,473 A1266S probably benign Het
Cyfip2 G A 11: 46,196,446 R1206C probably damaging Het
Cyp24a1 T A 2: 170,485,940 M461L probably damaging Het
Cyp2a5 C T 7: 26,835,515 T51I possibly damaging Het
Cyp2b19 C T 7: 26,767,140 H398Y possibly damaging Het
Cyp4a29 G A 4: 115,250,170 V234I probably benign Het
Dicer1 T G 12: 104,708,800 K734N probably damaging Het
Dnaic1 T C 4: 41,614,695 probably null Het
Entpd3 G A 9: 120,543,959 G14D probably damaging Het
Ermp1 T C 19: 29,617,967 T634A probably benign Het
Evc C T 5: 37,319,083 G374D probably damaging Het
Fam189b G A 3: 89,184,213 probably null Het
Fcgbp C A 7: 28,106,979 T2124K probably damaging Het
Fgf8 G A 19: 45,742,437 P50S probably benign Het
Galnt18 C T 7: 111,556,458 V223M possibly damaging Het
Galnt2 A G 8: 124,332,078 N295S probably benign Het
Gm9573 T A 17: 35,618,759 T1512S unknown Het
Grip1 T G 10: 120,018,106 V600G probably damaging Het
Insm2 T A 12: 55,600,538 C356S probably damaging Het
Itpr2 T A 6: 146,291,584 I1672F probably benign Het
Kdm1b T G 13: 47,050,622 N76K probably benign Het
Khnyn T A 14: 55,887,846 probably null Het
Kidins220 C T 12: 25,061,231 A1167V possibly damaging Het
Krt40 T C 11: 99,541,261 D208G probably benign Het
Lars T A 18: 42,217,562 D894V probably benign Het
Lmx1a A T 1: 167,840,952 N266I probably benign Het
Mrgprb5 T A 7: 48,168,249 K246M probably benign Het
Mrpl2 G A 17: 46,648,672 G176R possibly damaging Het
Nell1 T A 7: 49,982,800 F60L possibly damaging Het
Nnt G A 13: 119,370,094 A453V possibly damaging Het
Olfr366 C T 2: 37,219,711 T74I probably damaging Het
Olfr398 A C 11: 73,984,431 M59R probably damaging Het
Olfr697 T A 7: 106,741,413 I174F probably damaging Het
Opa1 A G 16: 29,648,937 K940R probably benign Het
Opn5 A C 17: 42,580,619 I309S probably null Het
P3h3 T G 6: 124,855,155 E256A possibly damaging Het
Pald1 G T 10: 61,355,814 T65K probably damaging Het
Pcnx3 T C 19: 5,685,961 Y279C probably damaging Het
Pik3c2b G A 1: 133,071,242 S367N possibly damaging Het
Pik3cb T C 9: 99,088,613 T342A probably benign Het
Pkd1l3 A T 8: 109,631,358 E837D possibly damaging Het
Ppp2r2b T A 18: 42,701,532 Y191F probably benign Het
Ppp4r4 G A 12: 103,590,821 E439K possibly damaging Het
Pqlc3 T A 12: 16,997,631 probably null Het
Ptprk A G 10: 28,568,408 I946V possibly damaging Het
Ror1 A G 4: 100,441,098 N556S probably benign Het
Ryr3 C T 2: 112,926,838 A391T possibly damaging Het
Selp G A 1: 164,145,015 probably null Het
Setx T C 2: 29,157,108 L1866S probably damaging Het
Setx T A 2: 29,179,854 V2557E possibly damaging Het
Slit2 A G 5: 48,244,683 T805A probably benign Het
Sorbs3 T G 14: 70,203,032 N89T possibly damaging Het
Sorl1 C A 9: 42,089,961 V248L probably benign Het
Srebf2 T A 15: 82,182,087 V612E probably damaging Het
Sv2c T A 13: 95,976,692 Y583F probably damaging Het
Tada1 G T 1: 166,389,873 R193I probably damaging Het
Tnrc6b C G 15: 80,880,379 A694G possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn C T 2: 76,881,081 G8372D unknown Het
Ube2g2 A G 10: 77,634,742 T68A Het
Ubl7 T G 9: 57,914,635 V89G possibly damaging Het
Ush2a T A 1: 188,759,841 I3109N probably damaging Het
Utp20 T A 10: 88,762,770 K115* probably null Het
Vmn2r26 T A 6: 124,039,799 Y407* probably null Het
Yod1 G T 1: 130,719,249 V288F probably damaging Het
Zbed5 A C 5: 129,901,957 N249T possibly damaging Het
Zbtb5 T C 4: 44,995,244 T47A probably damaging Het
Zcchc14 T C 8: 121,605,245 T460A not run Het
Zfp712 A C 13: 67,052,419 probably null Het
Zfyve16 A T 13: 92,522,328 H358Q probably benign Het
Other mutations in Fmnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Fmnl1 APN 11 103197340 nonsense probably null
IGL00972:Fmnl1 APN 11 103180955 missense probably damaging 1.00
IGL01406:Fmnl1 APN 11 103194690 unclassified probably benign
IGL01417:Fmnl1 APN 11 103196694 unclassified probably benign
IGL01599:Fmnl1 APN 11 103186656 missense probably damaging 1.00
IGL02151:Fmnl1 APN 11 103192772 missense probably benign 0.38
IGL02324:Fmnl1 APN 11 103179538 missense probably damaging 1.00
IGL02812:Fmnl1 APN 11 103196766 unclassified probably benign
IGL03369:Fmnl1 APN 11 103197182 splice site probably null
archetypal UTSW 11 103186627 missense probably damaging 1.00
contractual UTSW 11 103180915 missense probably damaging 1.00
stylistic UTSW 11 103193736 critical splice donor site probably null
R0077:Fmnl1 UTSW 11 103189969 missense probably damaging 1.00
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R0413:Fmnl1 UTSW 11 103194063 splice site probably benign
R1170:Fmnl1 UTSW 11 103197370 missense probably benign 0.02
R1389:Fmnl1 UTSW 11 103186709 splice site probably null
R1794:Fmnl1 UTSW 11 103197147 missense probably benign 0.00
R2082:Fmnl1 UTSW 11 103192025 missense probably damaging 1.00
R2105:Fmnl1 UTSW 11 103194692 missense probably benign 0.39
R3611:Fmnl1 UTSW 11 103194765 unclassified probably benign
R3883:Fmnl1 UTSW 11 103182114 missense probably damaging 1.00
R3893:Fmnl1 UTSW 11 103196757 unclassified probably benign
R4658:Fmnl1 UTSW 11 103197694 missense probably damaging 1.00
R4689:Fmnl1 UTSW 11 103193736 critical splice donor site probably null
R4812:Fmnl1 UTSW 11 103198564 unclassified probably benign
R4996:Fmnl1 UTSW 11 103182656 missense possibly damaging 0.58
R5646:Fmnl1 UTSW 11 103196512 unclassified probably benign
R5702:Fmnl1 UTSW 11 103185665 missense probably damaging 1.00
R5850:Fmnl1 UTSW 11 103195285 unclassified probably benign
R5903:Fmnl1 UTSW 11 103171444 splice site probably null
R6254:Fmnl1 UTSW 11 103196315 unclassified probably benign
R6958:Fmnl1 UTSW 11 103171314 start codon destroyed probably null 1.00
R7030:Fmnl1 UTSW 11 103194774 unclassified probably benign
R7133:Fmnl1 UTSW 11 103181784 critical splice donor site probably null
R7171:Fmnl1 UTSW 11 103190398 missense probably damaging 1.00
R7224:Fmnl1 UTSW 11 103182769 critical splice donor site probably null
R7282:Fmnl1 UTSW 11 103196265 missense unknown
R7448:Fmnl1 UTSW 11 103186627 missense probably damaging 1.00
R7463:Fmnl1 UTSW 11 103193128 missense probably damaging 1.00
R7862:Fmnl1 UTSW 11 103180930 missense probably damaging 1.00
R7973:Fmnl1 UTSW 11 103171158 start gained probably benign
R8177:Fmnl1 UTSW 11 103189959 missense probably damaging 0.98
R8273:Fmnl1 UTSW 11 103186699 missense probably damaging 1.00
R8345:Fmnl1 UTSW 11 103186614 missense possibly damaging 0.88
R8507:Fmnl1 UTSW 11 103194033 missense unknown
R8921:Fmnl1 UTSW 11 103197141 missense unknown
R8946:Fmnl1 UTSW 11 103180915 missense probably damaging 1.00
R8968:Fmnl1 UTSW 11 103186618 small deletion probably benign
R9114:Fmnl1 UTSW 11 103196501 missense unknown
Predicted Primers PCR Primer
(F):5'- TATTTCTCCCCACGCTGAGG -3'
(R):5'- GGGACACTCATTTACCACAGC -3'

Sequencing Primer
(F):5'- TCATATGCCAAGATGCCTGG -3'
(R):5'- AACATCCCAGCCATGTAGTG -3'
Posted On 2019-12-20