Incidental Mutation 'R7831:Dicer1'
ID 605651
Institutional Source Beutler Lab
Gene Symbol Dicer1
Ensembl Gene ENSMUSG00000041415
Gene Name dicer 1, ribonuclease type III
Synonyms D12Ertd7e, Dicer1, 1110006F08Rik
MMRRC Submission 045885-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7831 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 104654001-104718211 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 104675059 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 734 (K734N)
Ref Sequence ENSEMBL: ENSMUSP00000043676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041987]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000041987
AA Change: K734N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043676
Gene: ENSMUSG00000041415
AA Change: K734N

DomainStartEndE-ValueType
DEXDc 30 233 5.14e-24 SMART
low complexity region 403 419 N/A INTRINSIC
HELICc 449 546 3.15e-10 SMART
Pfam:Dicer_dimer 620 707 1.4e-25 PFAM
low complexity region 713 723 N/A INTRINSIC
PAZ 881 1056 1.67e-48 SMART
Blast:PAZ 1080 1129 2e-8 BLAST
RIBOc 1285 1582 1.83e-35 SMART
RIBOc 1665 1831 5.97e-49 SMART
DSRM 1834 1897 6.89e-9 SMART
Meta Mutation Damage Score 0.1105 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mutation of this locus results in arrest of early embryonic development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(14) Gene trapped(11)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,247,404 (GRCm39) V2384I possibly damaging Het
Acsl1 A G 8: 46,972,043 (GRCm39) D297G probably benign Het
Ap2a1 C A 7: 44,550,436 (GRCm39) R944L probably damaging Het
Apbb1ip A G 2: 22,756,933 (GRCm39) Y398C probably damaging Het
Atp8a2 A T 14: 60,011,202 (GRCm39) V968D probably damaging Het
Becn1 T C 11: 101,181,279 (GRCm39) T341A probably benign Het
Card11 G T 5: 140,859,167 (GRCm39) S1126R possibly damaging Het
Ccdc51 T C 9: 108,921,058 (GRCm39) L315S probably damaging Het
Cdk12 T C 11: 98,140,653 (GRCm39) L1298P unknown Het
Cep170b A T 12: 112,711,234 (GRCm39) D1538V probably benign Het
Cfap52 A T 11: 67,826,782 (GRCm39) F348I possibly damaging Het
Clip1 A T 5: 123,751,342 (GRCm39) M813K Het
Col19a1 G A 1: 24,565,563 (GRCm39) T256I unknown Het
Col6a3 A T 1: 90,724,268 (GRCm39) C2027* probably null Het
Crisp4 A T 1: 18,199,013 (GRCm39) N140K probably benign Het
Crocc2 G T 1: 93,143,195 (GRCm39) A1266S probably benign Het
Cyfip2 G A 11: 46,087,273 (GRCm39) R1206C probably damaging Het
Cyp24a1 T A 2: 170,327,860 (GRCm39) M461L probably damaging Het
Cyp2a5 C T 7: 26,534,940 (GRCm39) T51I possibly damaging Het
Cyp2b19 C T 7: 26,466,565 (GRCm39) H398Y possibly damaging Het
Cyp4a29 G A 4: 115,107,367 (GRCm39) V234I probably benign Het
Dnai1 T C 4: 41,614,695 (GRCm39) probably null Het
Entpd3 G A 9: 120,373,025 (GRCm39) G14D probably damaging Het
Entrep3 G A 3: 89,091,520 (GRCm39) probably null Het
Ermp1 T C 19: 29,595,367 (GRCm39) T634A probably benign Het
Evc C T 5: 37,476,427 (GRCm39) G374D probably damaging Het
Fcgbp C A 7: 27,806,404 (GRCm39) T2124K probably damaging Het
Fgf8 G A 19: 45,730,876 (GRCm39) P50S probably benign Het
Fmnl1 C T 11: 103,088,999 (GRCm39) R1074W unknown Het
Galnt18 C T 7: 111,155,665 (GRCm39) V223M possibly damaging Het
Galnt2 A G 8: 125,058,817 (GRCm39) N295S probably benign Het
Grip1 T G 10: 119,854,011 (GRCm39) V600G probably damaging Het
Insm2 T A 12: 55,647,323 (GRCm39) C356S probably damaging Het
Itpr2 T A 6: 146,193,082 (GRCm39) I1672F probably benign Het
Kdm1b T G 13: 47,204,098 (GRCm39) N76K probably benign Het
Khnyn T A 14: 56,125,303 (GRCm39) probably null Het
Kidins220 C T 12: 25,111,230 (GRCm39) A1167V possibly damaging Het
Krt40 T C 11: 99,432,087 (GRCm39) D208G probably benign Het
Lars1 T A 18: 42,350,627 (GRCm39) D894V probably benign Het
Lmx1a A T 1: 167,668,521 (GRCm39) N266I probably benign Het
Mrgprb5 T A 7: 47,817,997 (GRCm39) K246M probably benign Het
Mrpl2 G A 17: 46,959,598 (GRCm39) G176R possibly damaging Het
Muc21 T A 17: 35,929,651 (GRCm39) T1512S unknown Het
Nell1 T A 7: 49,632,548 (GRCm39) F60L possibly damaging Het
Nnt G A 13: 119,506,630 (GRCm39) A453V possibly damaging Het
Opa1 A G 16: 29,467,755 (GRCm39) K940R probably benign Het
Opn5 A C 17: 42,891,510 (GRCm39) I309S probably null Het
Or1af1 C T 2: 37,109,723 (GRCm39) T74I probably damaging Het
Or1r1 A C 11: 73,875,257 (GRCm39) M59R probably damaging Het
Or2ag15 T A 7: 106,340,620 (GRCm39) I174F probably damaging Het
P3h3 T G 6: 124,832,118 (GRCm39) E256A possibly damaging Het
Pald1 G T 10: 61,191,593 (GRCm39) T65K probably damaging Het
Pcnx3 T C 19: 5,735,989 (GRCm39) Y279C probably damaging Het
Pik3c2b G A 1: 132,998,980 (GRCm39) S367N possibly damaging Het
Pik3cb T C 9: 98,970,666 (GRCm39) T342A probably benign Het
Pkd1l3 A T 8: 110,357,990 (GRCm39) E837D possibly damaging Het
Ppp2r2b T A 18: 42,834,597 (GRCm39) Y191F probably benign Het
Ppp4r4 G A 12: 103,557,080 (GRCm39) E439K possibly damaging Het
Ptprk A G 10: 28,444,404 (GRCm39) I946V possibly damaging Het
Ror1 A G 4: 100,298,295 (GRCm39) N556S probably benign Het
Ryr3 C T 2: 112,757,183 (GRCm39) A391T possibly damaging Het
Selp G A 1: 163,972,584 (GRCm39) probably null Het
Setx T C 2: 29,047,120 (GRCm39) L1866S probably damaging Het
Setx T A 2: 29,069,866 (GRCm39) V2557E possibly damaging Het
Slc66a3 T A 12: 17,047,632 (GRCm39) probably null Het
Slit2 A G 5: 48,402,025 (GRCm39) T805A probably benign Het
Sorbs3 T G 14: 70,440,481 (GRCm39) N89T possibly damaging Het
Sorl1 C A 9: 42,001,257 (GRCm39) V248L probably benign Het
Srebf2 T A 15: 82,066,288 (GRCm39) V612E probably damaging Het
Sv2c T A 13: 96,113,200 (GRCm39) Y583F probably damaging Het
Tada1 G T 1: 166,217,442 (GRCm39) R193I probably damaging Het
Tnrc6b C G 15: 80,764,580 (GRCm39) A694G possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Ttn C T 2: 76,711,425 (GRCm39) G8372D unknown Het
Ube2g2 A G 10: 77,470,576 (GRCm39) T68A Het
Ubl7 T G 9: 57,821,918 (GRCm39) V89G possibly damaging Het
Ush2a T A 1: 188,492,038 (GRCm39) I3109N probably damaging Het
Utp20 T A 10: 88,598,632 (GRCm39) K115* probably null Het
Vmn2r26 T A 6: 124,016,758 (GRCm39) Y407* probably null Het
Yod1 G T 1: 130,646,986 (GRCm39) V288F probably damaging Het
Zbed5 A C 5: 129,930,798 (GRCm39) N249T possibly damaging Het
Zbtb5 T C 4: 44,995,244 (GRCm39) T47A probably damaging Het
Zcchc14 T C 8: 122,331,984 (GRCm39) T460A not run Het
Zfp712 A C 13: 67,200,483 (GRCm39) probably null Het
Zfyve16 A T 13: 92,658,836 (GRCm39) H358Q probably benign Het
Other mutations in Dicer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Dicer1 APN 12 104,663,031 (GRCm39) missense possibly damaging 0.93
IGL01061:Dicer1 APN 12 104,672,586 (GRCm39) missense probably null 0.75
IGL01527:Dicer1 APN 12 104,657,869 (GRCm39) nonsense probably null
IGL01597:Dicer1 APN 12 104,671,469 (GRCm39) nonsense probably null
IGL01636:Dicer1 APN 12 104,688,500 (GRCm39) missense probably damaging 1.00
IGL01717:Dicer1 APN 12 104,669,046 (GRCm39) nonsense probably null
IGL01765:Dicer1 APN 12 104,672,999 (GRCm39) missense probably damaging 1.00
IGL01871:Dicer1 APN 12 104,670,439 (GRCm39) missense probably damaging 1.00
IGL02316:Dicer1 APN 12 104,668,812 (GRCm39) missense probably damaging 1.00
IGL02317:Dicer1 APN 12 104,663,279 (GRCm39) missense probably damaging 1.00
IGL02539:Dicer1 APN 12 104,663,294 (GRCm39) missense probably damaging 0.97
IGL02544:Dicer1 APN 12 104,681,091 (GRCm39) missense probably damaging 1.00
IGL02664:Dicer1 APN 12 104,671,388 (GRCm39) missense probably damaging 1.00
IGL02667:Dicer1 APN 12 104,681,165 (GRCm39) missense probably damaging 1.00
IGL03353:Dicer1 APN 12 104,679,366 (GRCm39) missense probably damaging 1.00
IGL03377:Dicer1 APN 12 104,678,456 (GRCm39) missense probably damaging 0.98
everest UTSW 12 104,671,387 (GRCm39) missense probably damaging 1.00
PIT4480001:Dicer1 UTSW 12 104,662,803 (GRCm39) missense probably benign
R0032:Dicer1 UTSW 12 104,671,057 (GRCm39) nonsense probably null
R0032:Dicer1 UTSW 12 104,671,057 (GRCm39) nonsense probably null
R0219:Dicer1 UTSW 12 104,658,384 (GRCm39) critical splice donor site probably null
R0242:Dicer1 UTSW 12 104,668,710 (GRCm39) missense probably benign 0.02
R0242:Dicer1 UTSW 12 104,668,710 (GRCm39) missense probably benign 0.02
R0385:Dicer1 UTSW 12 104,670,433 (GRCm39) missense probably damaging 1.00
R0402:Dicer1 UTSW 12 104,697,323 (GRCm39) missense probably benign 0.04
R0426:Dicer1 UTSW 12 104,668,801 (GRCm39) missense probably damaging 1.00
R0453:Dicer1 UTSW 12 104,668,889 (GRCm39) missense probably benign
R0502:Dicer1 UTSW 12 104,671,319 (GRCm39) missense probably damaging 1.00
R0507:Dicer1 UTSW 12 104,657,917 (GRCm39) missense probably damaging 1.00
R0511:Dicer1 UTSW 12 104,669,100 (GRCm39) missense possibly damaging 0.95
R0523:Dicer1 UTSW 12 104,668,750 (GRCm39) missense probably damaging 1.00
R0559:Dicer1 UTSW 12 104,672,560 (GRCm39) missense probably damaging 1.00
R0600:Dicer1 UTSW 12 104,673,123 (GRCm39) missense probably damaging 1.00
R0707:Dicer1 UTSW 12 104,673,144 (GRCm39) missense probably damaging 1.00
R1225:Dicer1 UTSW 12 104,657,866 (GRCm39) missense probably damaging 0.98
R1351:Dicer1 UTSW 12 104,695,401 (GRCm39) missense probably damaging 0.99
R1449:Dicer1 UTSW 12 104,695,502 (GRCm39) missense possibly damaging 0.85
R1575:Dicer1 UTSW 12 104,688,228 (GRCm39) critical splice donor site probably null
R1642:Dicer1 UTSW 12 104,679,415 (GRCm39) missense probably damaging 1.00
R1651:Dicer1 UTSW 12 104,675,064 (GRCm39) missense probably damaging 1.00
R1658:Dicer1 UTSW 12 104,666,673 (GRCm39) missense probably benign
R1815:Dicer1 UTSW 12 104,688,410 (GRCm39) missense probably damaging 1.00
R1816:Dicer1 UTSW 12 104,688,410 (GRCm39) missense probably damaging 1.00
R1927:Dicer1 UTSW 12 104,669,143 (GRCm39) missense possibly damaging 0.91
R2113:Dicer1 UTSW 12 104,679,473 (GRCm39) missense probably damaging 1.00
R2129:Dicer1 UTSW 12 104,688,290 (GRCm39) missense probably damaging 1.00
R2157:Dicer1 UTSW 12 104,669,208 (GRCm39) missense probably benign 0.17
R2202:Dicer1 UTSW 12 104,697,297 (GRCm39) missense possibly damaging 0.95
R2203:Dicer1 UTSW 12 104,697,297 (GRCm39) missense possibly damaging 0.95
R2243:Dicer1 UTSW 12 104,696,447 (GRCm39) missense probably damaging 0.99
R4237:Dicer1 UTSW 12 104,695,487 (GRCm39) missense possibly damaging 0.48
R4419:Dicer1 UTSW 12 104,671,373 (GRCm39) missense probably damaging 1.00
R4482:Dicer1 UTSW 12 104,672,536 (GRCm39) missense probably damaging 1.00
R4564:Dicer1 UTSW 12 104,671,010 (GRCm39) nonsense probably null
R4776:Dicer1 UTSW 12 104,658,705 (GRCm39) missense probably damaging 0.99
R4834:Dicer1 UTSW 12 104,662,850 (GRCm39) missense probably benign 0.44
R4904:Dicer1 UTSW 12 104,679,325 (GRCm39) missense probably benign
R5202:Dicer1 UTSW 12 104,660,990 (GRCm39) nonsense probably null
R5272:Dicer1 UTSW 12 104,670,499 (GRCm39) missense probably damaging 1.00
R5363:Dicer1 UTSW 12 104,669,410 (GRCm39) missense probably damaging 1.00
R5717:Dicer1 UTSW 12 104,671,387 (GRCm39) missense probably damaging 1.00
R6381:Dicer1 UTSW 12 104,662,721 (GRCm39) missense probably benign 0.00
R6479:Dicer1 UTSW 12 104,662,982 (GRCm39) missense probably damaging 0.97
R6956:Dicer1 UTSW 12 104,697,282 (GRCm39) missense probably damaging 1.00
R7234:Dicer1 UTSW 12 104,675,108 (GRCm39) missense probably damaging 1.00
R7401:Dicer1 UTSW 12 104,678,537 (GRCm39) missense probably benign
R7407:Dicer1 UTSW 12 104,688,610 (GRCm39) nonsense probably null
R7471:Dicer1 UTSW 12 104,660,969 (GRCm39) missense probably damaging 1.00
R7699:Dicer1 UTSW 12 104,671,429 (GRCm39) missense probably damaging 1.00
R7768:Dicer1 UTSW 12 104,672,956 (GRCm39) missense probably damaging 0.99
R7998:Dicer1 UTSW 12 104,670,328 (GRCm39) missense probably damaging 1.00
R8010:Dicer1 UTSW 12 104,658,391 (GRCm39) missense probably damaging 0.99
R8061:Dicer1 UTSW 12 104,669,077 (GRCm39) nonsense probably null
R8213:Dicer1 UTSW 12 104,668,952 (GRCm39) missense probably benign 0.00
R8261:Dicer1 UTSW 12 104,657,865 (GRCm39) missense probably damaging 1.00
R8419:Dicer1 UTSW 12 104,668,936 (GRCm39) missense probably benign 0.00
R8708:Dicer1 UTSW 12 104,694,704 (GRCm39) missense possibly damaging 0.65
R8851:Dicer1 UTSW 12 104,690,300 (GRCm39) missense possibly damaging 0.76
R9220:Dicer1 UTSW 12 104,679,415 (GRCm39) missense probably damaging 1.00
R9371:Dicer1 UTSW 12 104,670,991 (GRCm39) missense probably damaging 1.00
R9387:Dicer1 UTSW 12 104,695,499 (GRCm39) missense possibly damaging 0.48
R9505:Dicer1 UTSW 12 104,697,297 (GRCm39) missense possibly damaging 0.95
R9636:Dicer1 UTSW 12 104,688,406 (GRCm39) nonsense probably null
R9682:Dicer1 UTSW 12 104,672,484 (GRCm39) missense probably damaging 1.00
X0018:Dicer1 UTSW 12 104,663,193 (GRCm39) missense probably benign 0.00
Z1176:Dicer1 UTSW 12 104,697,279 (GRCm39) missense probably null 0.97
Predicted Primers PCR Primer
(F):5'- ATACAAAGGCGGCTCTGGAG -3'
(R):5'- CCCCTAAAGTTTCAGCTGTGAC -3'

Sequencing Primer
(F):5'- TGGAGACGCCAGGAATCAG -3'
(R):5'- GAGCCCTGGAACTGTACTTAC -3'
Posted On 2019-12-20