Incidental Mutation 'R7831:Nnt'
ID605656
Institutional Source Beutler Lab
Gene Symbol Nnt
Ensembl Gene ENSMUSG00000025453
Gene Namenicotinamide nucleotide transhydrogenase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R7831 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location119335448-119408997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119370094 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 453 (A453V)
Ref Sequence ENSEMBL: ENSMUSP00000096753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069902] [ENSMUST00000099149] [ENSMUST00000109204] [ENSMUST00000223268]
Predicted Effect probably damaging
Transcript: ENSMUST00000069902
AA Change: A339V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070564
Gene: ENSMUSG00000025453
AA Change: A339V

DomainStartEndE-ValueType
AlaDh_PNT_N 60 199 3.35e-62 SMART
AlaDh_PNT_C 208 377 5.76e-43 SMART
transmembrane domain 409 431 N/A INTRINSIC
transmembrane domain 451 473 N/A INTRINSIC
transmembrane domain 486 508 N/A INTRINSIC
PDB:1U31|B 515 721 1e-145 PDB
SCOP:d1d4oa_ 542 718 1e-103 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000099149
AA Change: A453V

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096753
Gene: ENSMUSG00000025453
AA Change: A453V

DomainStartEndE-ValueType
AlaDh_PNT_N 60 199 3.35e-62 SMART
AlaDh_PNT_C 208 375 1.27e-39 SMART
transmembrane domain 395 412 N/A INTRINSIC
Blast:AlaDh_PNT_C 436 491 3e-28 BLAST
transmembrane domain 523 545 N/A INTRINSIC
transmembrane domain 565 587 N/A INTRINSIC
transmembrane domain 600 622 N/A INTRINSIC
PDB:1U31|B 629 835 1e-143 PDB
SCOP:d1d4oa_ 656 832 1e-102 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109204
AA Change: A453V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104827
Gene: ENSMUSG00000025453
AA Change: A453V

DomainStartEndE-ValueType
AlaDh_PNT_N 60 199 3.35e-62 SMART
AlaDh_PNT_C 208 375 1.27e-39 SMART
transmembrane domain 395 412 N/A INTRINSIC
Blast:AlaDh_PNT_C 436 491 2e-28 BLAST
transmembrane domain 523 545 N/A INTRINSIC
transmembrane domain 565 587 N/A INTRINSIC
transmembrane domain 600 622 N/A INTRINSIC
PDB:1U31|B 629 709 9e-46 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000223268
AA Change: A453V

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (87/87)
MGI Phenotype PHENOTYPE: Mutations in this gene cause impaired glucose tolerance and loss of both glucose-dependent insulin secretion and ATP production in isolated pancreatic islets. Also, beta cells from ENU-induced mutants show enhanced glucose utilization and production of reactive oxygen species in response to glucose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,297,404 V2384I possibly damaging Het
Acsl1 A G 8: 46,519,006 D297G probably benign Het
Ap2a1 C A 7: 44,901,012 R944L probably damaging Het
Apbb1ip A G 2: 22,866,921 Y398C probably damaging Het
Atp8a2 A T 14: 59,773,753 V968D probably damaging Het
Becn1 T C 11: 101,290,453 T341A probably benign Het
Card11 G T 5: 140,873,412 S1126R possibly damaging Het
Ccdc51 T C 9: 109,091,990 L315S probably damaging Het
Cdk12 T C 11: 98,249,827 L1298P unknown Het
Cep170b A T 12: 112,744,800 D1538V probably benign Het
Cfap52 A T 11: 67,935,956 F348I possibly damaging Het
Clip1 A T 5: 123,613,279 M813K Het
Col19a1 G A 1: 24,526,482 T256I unknown Het
Col6a3 A T 1: 90,796,546 C2027* probably null Het
Crisp4 A T 1: 18,128,789 N140K probably benign Het
Crocc2 G T 1: 93,215,473 A1266S probably benign Het
Cyfip2 G A 11: 46,196,446 R1206C probably damaging Het
Cyp24a1 T A 2: 170,485,940 M461L probably damaging Het
Cyp2a5 C T 7: 26,835,515 T51I possibly damaging Het
Cyp2b19 C T 7: 26,767,140 H398Y possibly damaging Het
Cyp4a29 G A 4: 115,250,170 V234I probably benign Het
Dicer1 T G 12: 104,708,800 K734N probably damaging Het
Dnaic1 T C 4: 41,614,695 probably null Het
Entpd3 G A 9: 120,543,959 G14D probably damaging Het
Ermp1 T C 19: 29,617,967 T634A probably benign Het
Evc C T 5: 37,319,083 G374D probably damaging Het
Fam189b G A 3: 89,184,213 probably null Het
Fcgbp C A 7: 28,106,979 T2124K probably damaging Het
Fgf8 G A 19: 45,742,437 P50S probably benign Het
Fmnl1 C T 11: 103,198,173 R1074W unknown Het
Galnt18 C T 7: 111,556,458 V223M possibly damaging Het
Galnt2 A G 8: 124,332,078 N295S probably benign Het
Gm9573 T A 17: 35,618,759 T1512S unknown Het
Grip1 T G 10: 120,018,106 V600G probably damaging Het
Insm2 T A 12: 55,600,538 C356S probably damaging Het
Itpr2 T A 6: 146,291,584 I1672F probably benign Het
Kdm1b T G 13: 47,050,622 N76K probably benign Het
Khnyn T A 14: 55,887,846 probably null Het
Kidins220 C T 12: 25,061,231 A1167V possibly damaging Het
Krt40 T C 11: 99,541,261 D208G probably benign Het
Lars T A 18: 42,217,562 D894V probably benign Het
Lmx1a A T 1: 167,840,952 N266I probably benign Het
Mrgprb5 T A 7: 48,168,249 K246M probably benign Het
Mrpl2 G A 17: 46,648,672 G176R possibly damaging Het
Nell1 T A 7: 49,982,800 F60L possibly damaging Het
Olfr366 C T 2: 37,219,711 T74I probably damaging Het
Olfr398 A C 11: 73,984,431 M59R probably damaging Het
Olfr697 T A 7: 106,741,413 I174F probably damaging Het
Opa1 A G 16: 29,648,937 K940R probably benign Het
Opn5 A C 17: 42,580,619 I309S probably null Het
P3h3 T G 6: 124,855,155 E256A possibly damaging Het
Pald1 G T 10: 61,355,814 T65K probably damaging Het
Pcnx3 T C 19: 5,685,961 Y279C probably damaging Het
Pik3c2b G A 1: 133,071,242 S367N possibly damaging Het
Pik3cb T C 9: 99,088,613 T342A probably benign Het
Pkd1l3 A T 8: 109,631,358 E837D possibly damaging Het
Ppp2r2b T A 18: 42,701,532 Y191F probably benign Het
Ppp4r4 G A 12: 103,590,821 E439K possibly damaging Het
Pqlc3 T A 12: 16,997,631 probably null Het
Ptprk A G 10: 28,568,408 I946V possibly damaging Het
Ror1 A G 4: 100,441,098 N556S probably benign Het
Ryr3 C T 2: 112,926,838 A391T possibly damaging Het
Selp G A 1: 164,145,015 probably null Het
Setx T C 2: 29,157,108 L1866S probably damaging Het
Setx T A 2: 29,179,854 V2557E possibly damaging Het
Slit2 A G 5: 48,244,683 T805A probably benign Het
Sorbs3 T G 14: 70,203,032 N89T possibly damaging Het
Sorl1 C A 9: 42,089,961 V248L probably benign Het
Srebf2 T A 15: 82,182,087 V612E probably damaging Het
Sv2c T A 13: 95,976,692 Y583F probably damaging Het
Tada1 G T 1: 166,389,873 R193I probably damaging Het
Tnrc6b C G 15: 80,880,379 A694G possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn C T 2: 76,881,081 G8372D unknown Het
Ube2g2 A G 10: 77,634,742 T68A Het
Ubl7 T G 9: 57,914,635 V89G possibly damaging Het
Ush2a T A 1: 188,759,841 I3109N probably damaging Het
Utp20 T A 10: 88,762,770 K115* probably null Het
Vmn2r26 T A 6: 124,039,799 Y407* probably null Het
Yod1 G T 1: 130,719,249 V288F probably damaging Het
Zbed5 A C 5: 129,901,957 N249T possibly damaging Het
Zbtb5 T C 4: 44,995,244 T47A probably damaging Het
Zcchc14 T C 8: 121,605,245 T460A not run Het
Zfp712 A C 13: 67,052,419 probably null Het
Zfyve16 A T 13: 92,522,328 H358Q probably benign Het
Other mutations in Nnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Nnt APN 13 119369997 missense probably damaging 1.00
IGL02021:Nnt APN 13 119336247 utr 3 prime probably benign
IGL02792:Nnt APN 13 119357646 missense probably damaging 1.00
IGL02804:Nnt APN 13 119381674 critical splice donor site probably null
IGL03082:Nnt APN 13 119396868 missense probably damaging 1.00
BB001:Nnt UTSW 13 119386645 missense probably damaging 1.00
BB011:Nnt UTSW 13 119386645 missense probably damaging 1.00
R0122:Nnt UTSW 13 119368597 missense probably damaging 1.00
R0294:Nnt UTSW 13 119336267 missense probably benign 0.08
R0294:Nnt UTSW 13 119338417 missense possibly damaging 0.79
R0530:Nnt UTSW 13 119394721 missense probably damaging 1.00
R0839:Nnt UTSW 13 119394656 missense possibly damaging 0.86
R1590:Nnt UTSW 13 119386661 missense possibly damaging 0.90
R1642:Nnt UTSW 13 119404550 critical splice donor site probably null
R3772:Nnt UTSW 13 119396952 missense probably damaging 0.99
R3835:Nnt UTSW 13 119372495 missense probably damaging 1.00
R3921:Nnt UTSW 13 119366494 missense probably damaging 1.00
R4106:Nnt UTSW 13 119396791 missense probably benign 0.15
R4496:Nnt UTSW 13 119381765 missense probably damaging 1.00
R4609:Nnt UTSW 13 119357536 missense possibly damaging 0.80
R4897:Nnt UTSW 13 119404571 nonsense probably null
R5081:Nnt UTSW 13 119366400 missense probably damaging 0.98
R5461:Nnt UTSW 13 119368595 missense possibly damaging 0.96
R5842:Nnt UTSW 13 119394747 missense probably damaging 0.97
R6053:Nnt UTSW 13 119357509 missense possibly damaging 0.90
R6137:Nnt UTSW 13 119336328 missense possibly damaging 0.95
R7134:Nnt UTSW 13 119394662 missense probably damaging 0.98
R7815:Nnt UTSW 13 119357575 missense possibly damaging 0.80
R7924:Nnt UTSW 13 119386645 missense probably damaging 1.00
R8046:Nnt UTSW 13 119374750 missense probably damaging 1.00
R8152:Nnt UTSW 13 119374676 missense probably benign 0.23
R8356:Nnt UTSW 13 119339832 missense probably damaging 1.00
R8461:Nnt UTSW 13 119368502 missense unknown
R8839:Nnt UTSW 13 119357637 missense unknown
R8860:Nnt UTSW 13 119339871 missense
RF007:Nnt UTSW 13 119396857 missense probably damaging 1.00
Z1088:Nnt UTSW 13 119338446 missense probably damaging 1.00
Z1177:Nnt UTSW 13 119354741 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGAAACAGACCCATAGATACCCTGG -3'
(R):5'- AGTCCATACTGGGAACTGGG -3'

Sequencing Primer
(F):5'- CCCATAGATACCCTGGAAAATAGTC -3'
(R):5'- CCATACTGGGAACTGGGTAATGCTC -3'
Posted On2019-12-20