Mutagenetix > Incidental Mutation

Incidental Mutation 'R7831:Tnrc6b'

605660

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6b

Ensembl Gene

ENSMUSG00000047888

Gene Name

trinucleotide repeat containing 6b

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.168) question?

Stock #

R7831 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80711313-80941085 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 80880379 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glycine at position 694 (A694G)

Ref Sequence

ENSEMBL: ENSMUSP00000064336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067689]

AlphaFold

Q8BKI2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067689
AA Change: A694G

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: A694G

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
coiled coil region	33	72	N/A	INTRINSIC
low complexity region	88	106	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC
low complexity region	207	220	N/A	INTRINSIC
low complexity region	242	260	N/A	INTRINSIC
low complexity region	331	346	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	416	425	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
internal_repeat_1	488	667	6.43e-5	PROSPERO
low complexity region	858	888	N/A	INTRINSIC
Pfam:Ago_hook	955	1095	1.2e-28	PFAM
coiled coil region	1258	1307	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1339	1623	2.8e-112	PFAM
Pfam:RRM_5	1641	1695	2e-7	PFAM
low complexity region	1705	1721	N/A	INTRINSIC
low complexity region	1748	1769	N/A	INTRINSIC
low complexity region	1792	1809	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000228124

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (87/87)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	G	A	11: 9,297,404	V2384I	possibly damaging	Het
Acsl1	A	G	8: 46,519,006	D297G	probably benign	Het
Ap2a1	C	A	7: 44,901,012	R944L	probably damaging	Het
Apbb1ip	A	G	2: 22,866,921	Y398C	probably damaging	Het
Atp8a2	A	T	14: 59,773,753	V968D	probably damaging	Het
Becn1	T	C	11: 101,290,453	T341A	probably benign	Het
Card11	G	T	5: 140,873,412	S1126R	possibly damaging	Het
Ccdc51	T	C	9: 109,091,990	L315S	probably damaging	Het
Cdk12	T	C	11: 98,249,827	L1298P	unknown	Het
Cep170b	A	T	12: 112,744,800	D1538V	probably benign	Het
Cfap52	A	T	11: 67,935,956	F348I	possibly damaging	Het
Clip1	A	T	5: 123,613,279	M813K		Het
Col19a1	G	A	1: 24,526,482	T256I	unknown	Het
Col6a3	A	T	1: 90,796,546	C2027*	probably null	Het
Crisp4	A	T	1: 18,128,789	N140K	probably benign	Het
Crocc2	G	T	1: 93,215,473	A1266S	probably benign	Het
Cyfip2	G	A	11: 46,196,446	R1206C	probably damaging	Het
Cyp24a1	T	A	2: 170,485,940	M461L	probably damaging	Het
Cyp2a5	C	T	7: 26,835,515	T51I	possibly damaging	Het
Cyp2b19	C	T	7: 26,767,140	H398Y	possibly damaging	Het
Cyp4a29	G	A	4: 115,250,170	V234I	probably benign	Het
Dicer1	T	G	12: 104,708,800	K734N	probably damaging	Het
Dnaic1	T	C	4: 41,614,695		probably null	Het
Entpd3	G	A	9: 120,543,959	G14D	probably damaging	Het
Ermp1	T	C	19: 29,617,967	T634A	probably benign	Het
Evc	C	T	5: 37,319,083	G374D	probably damaging	Het
Fam189b	G	A	3: 89,184,213		probably null	Het
Fcgbp	C	A	7: 28,106,979	T2124K	probably damaging	Het
Fgf8	G	A	19: 45,742,437	P50S	probably benign	Het
Fmnl1	C	T	11: 103,198,173	R1074W	unknown	Het
Galnt18	C	T	7: 111,556,458	V223M	possibly damaging	Het
Galnt2	A	G	8: 124,332,078	N295S	probably benign	Het
Gm9573	T	A	17: 35,618,759	T1512S	unknown	Het
Grip1	T	G	10: 120,018,106	V600G	probably damaging	Het
Insm2	T	A	12: 55,600,538	C356S	probably damaging	Het
Itpr2	T	A	6: 146,291,584	I1672F	probably benign	Het
Kdm1b	T	G	13: 47,050,622	N76K	probably benign	Het
Khnyn	T	A	14: 55,887,846		probably null	Het
Kidins220	C	T	12: 25,061,231	A1167V	possibly damaging	Het
Krt40	T	C	11: 99,541,261	D208G	probably benign	Het
Lars	T	A	18: 42,217,562	D894V	probably benign	Het
Lmx1a	A	T	1: 167,840,952	N266I	probably benign	Het
Mrgprb5	T	A	7: 48,168,249	K246M	probably benign	Het
Mrpl2	G	A	17: 46,648,672	G176R	possibly damaging	Het
Nell1	T	A	7: 49,982,800	F60L	possibly damaging	Het
Nnt	G	A	13: 119,370,094	A453V	possibly damaging	Het
Olfr366	C	T	2: 37,219,711	T74I	probably damaging	Het
Olfr398	A	C	11: 73,984,431	M59R	probably damaging	Het
Olfr697	T	A	7: 106,741,413	I174F	probably damaging	Het
Opa1	A	G	16: 29,648,937	K940R	probably benign	Het
Opn5	A	C	17: 42,580,619	I309S	probably null	Het
P3h3	T	G	6: 124,855,155	E256A	possibly damaging	Het
Pald1	G	T	10: 61,355,814	T65K	probably damaging	Het
Pcnx3	T	C	19: 5,685,961	Y279C	probably damaging	Het
Pik3c2b	G	A	1: 133,071,242	S367N	possibly damaging	Het
Pik3cb	T	C	9: 99,088,613	T342A	probably benign	Het
Pkd1l3	A	T	8: 109,631,358	E837D	possibly damaging	Het
Ppp2r2b	T	A	18: 42,701,532	Y191F	probably benign	Het
Ppp4r4	G	A	12: 103,590,821	E439K	possibly damaging	Het
Pqlc3	T	A	12: 16,997,631		probably null	Het
Ptprk	A	G	10: 28,568,408	I946V	possibly damaging	Het
Ror1	A	G	4: 100,441,098	N556S	probably benign	Het
Ryr3	C	T	2: 112,926,838	A391T	possibly damaging	Het
Selp	G	A	1: 164,145,015		probably null	Het
Setx	T	C	2: 29,157,108	L1866S	probably damaging	Het
Setx	T	A	2: 29,179,854	V2557E	possibly damaging	Het
Slit2	A	G	5: 48,244,683	T805A	probably benign	Het
Sorbs3	T	G	14: 70,203,032	N89T	possibly damaging	Het
Sorl1	C	A	9: 42,089,961	V248L	probably benign	Het
Srebf2	T	A	15: 82,182,087	V612E	probably damaging	Het
Sv2c	T	A	13: 95,976,692	Y583F	probably damaging	Het
Tada1	G	T	1: 166,389,873	R193I	probably damaging	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Ttn	C	T	2: 76,881,081	G8372D	unknown	Het
Ube2g2	A	G	10: 77,634,742	T68A		Het
Ubl7	T	G	9: 57,914,635	V89G	possibly damaging	Het
Ush2a	T	A	1: 188,759,841	I3109N	probably damaging	Het
Utp20	T	A	10: 88,762,770	K115*	probably null	Het
Vmn2r26	T	A	6: 124,039,799	Y407*	probably null	Het
Yod1	G	T	1: 130,719,249	V288F	probably damaging	Het
Zbed5	A	C	5: 129,901,957	N249T	possibly damaging	Het
Zbtb5	T	C	4: 44,995,244	T47A	probably damaging	Het
Zcchc14	T	C	8: 121,605,245	T460A	not run	Het
Zfp712	A	C	13: 67,052,419		probably null	Het
Zfyve16	A	T	13: 92,522,328	H358Q	probably benign	Het

Other mutations in Tnrc6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01312:Tnrc6b	APN	15	80923578	missense	probably damaging	1.00
IGL01402:Tnrc6b	APN	15	80880544	missense	possibly damaging	0.71
IGL01505:Tnrc6b	APN	15	80879963	missense	probably benign	0.00
IGL01516:Tnrc6b	APN	15	80902622	missense	possibly damaging	0.93
IGL01584:Tnrc6b	APN	15	80879682	missense	probably benign	0.01
IGL01681:Tnrc6b	APN	15	80879311	splice site	probably null
IGL01909:Tnrc6b	APN	15	80901983	missense	possibly damaging	0.88
IGL01943:Tnrc6b	APN	15	80927695	nonsense	probably null
IGL02253:Tnrc6b	APN	15	80876541	missense	probably damaging	0.99
IGL02260:Tnrc6b	APN	15	80880171	missense	probably damaging	0.99
IGL02437:Tnrc6b	APN	15	80880457	missense	probably damaging	1.00
IGL02541:Tnrc6b	APN	15	80879831	missense	probably benign	0.00
IGL02542:Tnrc6b	APN	15	80902352	missense	possibly damaging	0.83
grosser	UTSW	15	80929285	missense	probably damaging	1.00
heiliger	UTSW	15	80927741	critical splice donor site	probably null
PIT1430001:Tnrc6b	UTSW	15	80929186	missense	probably damaging	0.99
R0092:Tnrc6b	UTSW	15	80918528	missense	probably damaging	1.00
R0165:Tnrc6b	UTSW	15	80858670	splice site	probably null
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0257:Tnrc6b	UTSW	15	80894355	missense	possibly damaging	0.80
R0418:Tnrc6b	UTSW	15	80913323	missense	probably benign	0.27
R0432:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0487:Tnrc6b	UTSW	15	80880675	missense	probably benign	0.01
R0498:Tnrc6b	UTSW	15	80858719	missense	probably damaging	0.98
R0528:Tnrc6b	UTSW	15	80879403	missense	probably benign	0.00
R0533:Tnrc6b	UTSW	15	80876653	missense	probably benign	0.00
R0571:Tnrc6b	UTSW	15	80913338	missense	probably damaging	1.00
R0650:Tnrc6b	UTSW	15	80784758	missense	probably benign	0.33
R0659:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0884:Tnrc6b	UTSW	15	80902555	small deletion	probably benign
R1131:Tnrc6b	UTSW	15	80894453	missense	possibly damaging	0.45
R1188:Tnrc6b	UTSW	15	80879229	missense	probably benign
R1479:Tnrc6b	UTSW	15	80887032	splice site	probably null
R1564:Tnrc6b	UTSW	15	80880168	missense	possibly damaging	0.95
R1645:Tnrc6b	UTSW	15	80882958	missense	probably damaging	0.99
R1924:Tnrc6b	UTSW	15	80884206	critical splice acceptor site	probably null
R1926:Tnrc6b	UTSW	15	80881162	missense	probably damaging	1.00
R1928:Tnrc6b	UTSW	15	80880723	missense	probably damaging	1.00
R1965:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R1966:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R2072:Tnrc6b	UTSW	15	80882965	missense	possibly damaging	0.89
R3084:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3552:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3736:Tnrc6b	UTSW	15	80889163	splice site	probably benign
R3791:Tnrc6b	UTSW	15	80923640	missense	probably damaging	1.00
R4170:Tnrc6b	UTSW	15	80916787	missense	probably benign	0.24
R4276:Tnrc6b	UTSW	15	80901971	missense	probably benign	0.42
R4519:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R5380:Tnrc6b	UTSW	15	80879565	missense	possibly damaging	0.56
R5470:Tnrc6b	UTSW	15	80916711	missense	possibly damaging	0.89
R5590:Tnrc6b	UTSW	15	80876502	missense	probably damaging	0.98
R5982:Tnrc6b	UTSW	15	80880816	missense	probably benign
R6269:Tnrc6b	UTSW	15	80880743	missense	probably benign	0.42
R6331:Tnrc6b	UTSW	15	80879614	missense	probably benign	0.00
R6484:Tnrc6b	UTSW	15	80879324	missense	possibly damaging	0.92
R6622:Tnrc6b	UTSW	15	80879184	missense	probably damaging	0.99
R6695:Tnrc6b	UTSW	15	80879773	missense	probably damaging	1.00
R6728:Tnrc6b	UTSW	15	80918526	missense	probably damaging	1.00
R6776:Tnrc6b	UTSW	15	80924119	missense	possibly damaging	0.87
R7159:Tnrc6b	UTSW	15	80887022	missense	possibly damaging	0.92
R7210:Tnrc6b	UTSW	15	80929285	missense	probably damaging	1.00
R7287:Tnrc6b	UTSW	15	80879541	missense	possibly damaging	0.83
R7402:Tnrc6b	UTSW	15	80884300	missense	probably damaging	1.00
R7479:Tnrc6b	UTSW	15	80889126	missense	probably benign	0.13
R7533:Tnrc6b	UTSW	15	80927741	critical splice donor site	probably null
R7571:Tnrc6b	UTSW	15	80929393	missense	probably benign
R7594:Tnrc6b	UTSW	15	80880307	missense	possibly damaging	0.66
R8208:Tnrc6b	UTSW	15	80858700	missense	possibly damaging	0.53
R8276:Tnrc6b	UTSW	15	80880717	missense	probably benign	0.00
R8295:Tnrc6b	UTSW	15	80913364	missense	probably damaging	1.00
R8351:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8423:Tnrc6b	UTSW	15	80929418	missense	unknown
R8451:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8725:Tnrc6b	UTSW	15	80876452	missense	probably damaging	1.00
R8872:Tnrc6b	UTSW	15	80918089	missense	probably benign	0.23
R9029:Tnrc6b	UTSW	15	80878978	missense	possibly damaging	0.83
R9057:Tnrc6b	UTSW	15	80879148	missense	probably benign
R9240:Tnrc6b	UTSW	15	80880061	missense	probably damaging	0.98
R9450:Tnrc6b	UTSW	15	80880436	missense	probably benign	0.01
R9539:Tnrc6b	UTSW	15	80876343	missense	probably damaging	0.99
R9646:Tnrc6b	UTSW	15	80889065	missense	possibly damaging	0.89
X0020:Tnrc6b	UTSW	15	80882997	missense	probably benign	0.16
X0025:Tnrc6b	UTSW	15	80881167	missense	probably benign	0.03
Z1088:Tnrc6b	UTSW	15	80927690	nonsense	probably null
Z1177:Tnrc6b	UTSW	15	80858699	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- CTGATTGCCAGGCTGTCTTG -3'
(R):5'- AGAAGTCCATCCTTGGTTGGG -3'

Sequencing Primer
(F):5'- TAAGCAGGACACAGTGTG -3'
(R):5'- CCAAGAGGAAGGTGTCTTTTCATC -3'

Posted On

2019-12-20