Mutagenetix > Incidental Mutation

Incidental Mutation 'R7831:Ppp2r2b'

605667

Institutional Source

Beutler Lab

Gene Symbol

Ppp2r2b

Ensembl Gene

ENSMUSG00000024500

Gene Name

protein phosphatase 2, regulatory subunit B, beta

Synonyms

SCA12, 6330404L05Rik, 2900026H06Rik, E130009M08Rik, PR55-BETA, PP2A-PR55B

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7831 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

42637432-43059471 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 42701532 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 191 (Y191F)

Ref Sequence

ENSEMBL: ENSMUSP00000025377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025377] [ENSMUST00000117687] [ENSMUST00000120632]

AlphaFold

Q6ZWR4

Predicted Effect

probably benign
Transcript: ENSMUST00000025377
AA Change: Y191F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000025377
Gene: ENSMUSG00000024500
AA Change: Y191F

Domain	Start	End	E-Value	Type
WD40	14	55	6.42e-1	SMART
WD40	82	122	3.7e0	SMART
WD40	164	203	1.66e0	SMART
WD40	214	254	1.38e1	SMART
WD40	273	311	5.7e1	SMART
Blast:WD40	315	369	6e-26	BLAST
WD40	405	442	1.33e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117687
AA Change: Y188F

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000113731
Gene: ENSMUSG00000024500
AA Change: Y188F

Domain	Start	End	E-Value	Type
WD40	13	52	1.92e0	SMART
WD40	79	119	3.7e0	SMART
WD40	161	200	1.66e0	SMART
WD40	211	251	1.38e1	SMART
WD40	270	308	5.7e1	SMART
Blast:WD40	312	366	4e-26	BLAST
WD40	402	439	1.33e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000120632
AA Change: Y188F

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000113411
Gene: ENSMUSG00000024500
AA Change: Y188F

Domain	Start	End	E-Value	Type
WD40	13	52	1.92e0	SMART
WD40	79	119	3.7e0	SMART
WD40	161	200	1.66e0	SMART
WD40	211	251	1.38e1	SMART
WD40	270	308	5.7e1	SMART
Blast:WD40	312	366	4e-26	BLAST
WD40	402	439	1.33e1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (87/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a beta isoform of the regulatory subunit B55 subfamily. Defects in this gene cause autosomal dominant spinocerebellar ataxia 12 (SCA12), a disease caused by degeneration of the cerebellum, sometimes involving the brainstem and spinal cord, and in resulting in poor coordination of speech and body movements. Multiple alternatively spliced variants, which encode different isoforms, have been identified for this gene. The 5' UTR of some of these variants includes a CAG trinucleotide repeat sequence (7-28 copies) that can be expanded to 55-78 copies in cases of SCA12. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	G	A	11: 9,297,404	V2384I	possibly damaging	Het
Acsl1	A	G	8: 46,519,006	D297G	probably benign	Het
Ap2a1	C	A	7: 44,901,012	R944L	probably damaging	Het
Apbb1ip	A	G	2: 22,866,921	Y398C	probably damaging	Het
Atp8a2	A	T	14: 59,773,753	V968D	probably damaging	Het
Becn1	T	C	11: 101,290,453	T341A	probably benign	Het
Card11	G	T	5: 140,873,412	S1126R	possibly damaging	Het
Ccdc51	T	C	9: 109,091,990	L315S	probably damaging	Het
Cdk12	T	C	11: 98,249,827	L1298P	unknown	Het
Cep170b	A	T	12: 112,744,800	D1538V	probably benign	Het
Cfap52	A	T	11: 67,935,956	F348I	possibly damaging	Het
Clip1	A	T	5: 123,613,279	M813K		Het
Col19a1	G	A	1: 24,526,482	T256I	unknown	Het
Col6a3	A	T	1: 90,796,546	C2027*	probably null	Het
Crisp4	A	T	1: 18,128,789	N140K	probably benign	Het
Crocc2	G	T	1: 93,215,473	A1266S	probably benign	Het
Cyfip2	G	A	11: 46,196,446	R1206C	probably damaging	Het
Cyp24a1	T	A	2: 170,485,940	M461L	probably damaging	Het
Cyp2a5	C	T	7: 26,835,515	T51I	possibly damaging	Het
Cyp2b19	C	T	7: 26,767,140	H398Y	possibly damaging	Het
Cyp4a29	G	A	4: 115,250,170	V234I	probably benign	Het
Dicer1	T	G	12: 104,708,800	K734N	probably damaging	Het
Dnaic1	T	C	4: 41,614,695		probably null	Het
Entpd3	G	A	9: 120,543,959	G14D	probably damaging	Het
Ermp1	T	C	19: 29,617,967	T634A	probably benign	Het
Evc	C	T	5: 37,319,083	G374D	probably damaging	Het
Fam189b	G	A	3: 89,184,213		probably null	Het
Fcgbp	C	A	7: 28,106,979	T2124K	probably damaging	Het
Fgf8	G	A	19: 45,742,437	P50S	probably benign	Het
Fmnl1	C	T	11: 103,198,173	R1074W	unknown	Het
Galnt18	C	T	7: 111,556,458	V223M	possibly damaging	Het
Galnt2	A	G	8: 124,332,078	N295S	probably benign	Het
Gm9573	T	A	17: 35,618,759	T1512S	unknown	Het
Grip1	T	G	10: 120,018,106	V600G	probably damaging	Het
Insm2	T	A	12: 55,600,538	C356S	probably damaging	Het
Itpr2	T	A	6: 146,291,584	I1672F	probably benign	Het
Kdm1b	T	G	13: 47,050,622	N76K	probably benign	Het
Khnyn	T	A	14: 55,887,846		probably null	Het
Kidins220	C	T	12: 25,061,231	A1167V	possibly damaging	Het
Krt40	T	C	11: 99,541,261	D208G	probably benign	Het
Lars	T	A	18: 42,217,562	D894V	probably benign	Het
Lmx1a	A	T	1: 167,840,952	N266I	probably benign	Het
Mrgprb5	T	A	7: 48,168,249	K246M	probably benign	Het
Mrpl2	G	A	17: 46,648,672	G176R	possibly damaging	Het
Nell1	T	A	7: 49,982,800	F60L	possibly damaging	Het
Nnt	G	A	13: 119,370,094	A453V	possibly damaging	Het
Olfr366	C	T	2: 37,219,711	T74I	probably damaging	Het
Olfr398	A	C	11: 73,984,431	M59R	probably damaging	Het
Olfr697	T	A	7: 106,741,413	I174F	probably damaging	Het
Opa1	A	G	16: 29,648,937	K940R	probably benign	Het
Opn5	A	C	17: 42,580,619	I309S	probably null	Het
P3h3	T	G	6: 124,855,155	E256A	possibly damaging	Het
Pald1	G	T	10: 61,355,814	T65K	probably damaging	Het
Pcnx3	T	C	19: 5,685,961	Y279C	probably damaging	Het
Pik3c2b	G	A	1: 133,071,242	S367N	possibly damaging	Het
Pik3cb	T	C	9: 99,088,613	T342A	probably benign	Het
Pkd1l3	A	T	8: 109,631,358	E837D	possibly damaging	Het
Ppp4r4	G	A	12: 103,590,821	E439K	possibly damaging	Het
Pqlc3	T	A	12: 16,997,631		probably null	Het
Ptprk	A	G	10: 28,568,408	I946V	possibly damaging	Het
Ror1	A	G	4: 100,441,098	N556S	probably benign	Het
Ryr3	C	T	2: 112,926,838	A391T	possibly damaging	Het
Selp	G	A	1: 164,145,015		probably null	Het
Setx	T	C	2: 29,157,108	L1866S	probably damaging	Het
Setx	T	A	2: 29,179,854	V2557E	possibly damaging	Het
Slit2	A	G	5: 48,244,683	T805A	probably benign	Het
Sorbs3	T	G	14: 70,203,032	N89T	possibly damaging	Het
Sorl1	C	A	9: 42,089,961	V248L	probably benign	Het
Srebf2	T	A	15: 82,182,087	V612E	probably damaging	Het
Sv2c	T	A	13: 95,976,692	Y583F	probably damaging	Het
Tada1	G	T	1: 166,389,873	R193I	probably damaging	Het
Tnrc6b	C	G	15: 80,880,379	A694G	possibly damaging	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Ttn	C	T	2: 76,881,081	G8372D	unknown	Het
Ube2g2	A	G	10: 77,634,742	T68A		Het
Ubl7	T	G	9: 57,914,635	V89G	possibly damaging	Het
Ush2a	T	A	1: 188,759,841	I3109N	probably damaging	Het
Utp20	T	A	10: 88,762,770	K115*	probably null	Het
Vmn2r26	T	A	6: 124,039,799	Y407*	probably null	Het
Yod1	G	T	1: 130,719,249	V288F	probably damaging	Het
Zbed5	A	C	5: 129,901,957	N249T	possibly damaging	Het
Zbtb5	T	C	4: 44,995,244	T47A	probably damaging	Het
Zcchc14	T	C	8: 121,605,245	T460A	not run	Het
Zfp712	A	C	13: 67,052,419		probably null	Het
Zfyve16	A	T	13: 92,522,328	H358Q	probably benign	Het

Other mutations in Ppp2r2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:Ppp2r2b	APN	18	42645775	missense	probably damaging	0.99
IGL01999:Ppp2r2b	APN	18	42645723	utr 3 prime	probably benign
IGL02610:Ppp2r2b	APN	18	42648775	splice site	probably benign
IGL02733:Ppp2r2b	APN	18	42648728	missense	possibly damaging	0.96
IGL02899:Ppp2r2b	APN	18	42645809	missense	probably damaging	1.00
Degradation	UTSW	18	42688338	missense	probably benign	0.27
R0737:Ppp2r2b	UTSW	18	43059192	missense	probably benign
R1459:Ppp2r2b	UTSW	18	42737990	missense	probably damaging	1.00
R1616:Ppp2r2b	UTSW	18	42688310	missense	probably benign	0.32
R1635:Ppp2r2b	UTSW	18	43059210	missense	probably benign	0.01
R3435:Ppp2r2b	UTSW	18	42741109	missense	possibly damaging	0.48
R4204:Ppp2r2b	UTSW	18	42738050	missense	probably benign
R4301:Ppp2r2b	UTSW	18	42898746	missense	probably null
R5062:Ppp2r2b	UTSW	18	42688461	missense	possibly damaging	0.48
R5147:Ppp2r2b	UTSW	18	42645877	missense	probably benign	0.00
R5207:Ppp2r2b	UTSW	18	42688352	missense	probably damaging	1.00
R5277:Ppp2r2b	UTSW	18	42741142	missense	probably damaging	1.00
R6004:Ppp2r2b	UTSW	18	43059159	splice site	probably null
R6528:Ppp2r2b	UTSW	18	42688338	missense	probably benign	0.27
R6735:Ppp2r2b	UTSW	18	42688588	splice site	probably null
R7521:Ppp2r2b	UTSW	18	43059177	missense	probably benign
R8405:Ppp2r2b	UTSW	18	42645740	missense	probably benign	0.00
R8486:Ppp2r2b	UTSW	18	42898804	missense	probably benign	0.17
R8906:Ppp2r2b	UTSW	18	42688334	missense	probably damaging	1.00
R8998:Ppp2r2b	UTSW	18	42737928	missense	probably benign	0.37
R8999:Ppp2r2b	UTSW	18	42737928	missense	probably benign	0.37
R9081:Ppp2r2b	UTSW	18	42648760	missense	probably benign	0.41
R9201:Ppp2r2b	UTSW	18	42738036	missense	possibly damaging	0.87
R9303:Ppp2r2b	UTSW	18	42645960	missense	possibly damaging	0.82
R9305:Ppp2r2b	UTSW	18	42645960	missense	possibly damaging	0.82
Z1177:Ppp2r2b	UTSW	18	42648693	missense	probably benign	0.04
Z1177:Ppp2r2b	UTSW	18	42688423	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCCTTCATAGATGCCAGAC -3'
(R):5'- GACAGAGCATGAACCCATTTTG -3'

Sequencing Primer
(F):5'- GATGCCAGACATTTCCATTTTGACG -3'
(R):5'- CAGAGCATGAACCCATTTTGTACAAG -3'

Posted On

2019-12-20