Incidental Mutation 'R7832:Pkhd1'
ID 605671
Institutional Source Beutler Lab
Gene Symbol Pkhd1
Ensembl Gene ENSMUSG00000043760
Gene Name polycystic kidney and hepatic disease 1
Synonyms FPC, tigmin
MMRRC Submission 045886-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R7832 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 20128003-20688288 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20573223 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1894 (N1894K)
Ref Sequence ENSEMBL: ENSMUSP00000085794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088448]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000088448
AA Change: N1894K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085794
Gene: ENSMUSG00000043760
AA Change: N1894K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:IPT 134 254 1e-45 BLAST
IPT 256 353 1.13e-3 SMART
low complexity region 722 743 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Pfam:TIG 936 1005 9.1e-8 PFAM
IPT 1016 1101 1.18e-6 SMART
IPT 1105 1190 1.27e0 SMART
IPT 1193 1290 7.05e-5 SMART
IPT 1384 1467 1.36e1 SMART
IPT 1568 1655 2.4e0 SMART
low complexity region 1881 1892 N/A INTRINSIC
G8 1928 2049 1.15e-48 SMART
low complexity region 2079 2094 N/A INTRINSIC
PbH1 2244 2266 7.82e3 SMART
PbH1 2287 2321 2.23e3 SMART
PbH1 2404 2426 7.19e2 SMART
PbH1 2459 2481 2.64e2 SMART
low complexity region 2713 2728 N/A INTRINSIC
G8 2734 2867 1.73e-43 SMART
Blast:G8 2876 2923 2e-17 BLAST
PbH1 3004 3026 3.98e3 SMART
PbH1 3027 3049 1.27e0 SMART
PbH1 3080 3102 5.92e2 SMART
low complexity region 3178 3187 N/A INTRINSIC
PbH1 3188 3212 8.08e3 SMART
transmembrane domain 3852 3874 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (78/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to have a single transmembrane (TM)-spanning domain and multiple copies of an immunoglobulin-like plexin-transcription-factor domain. Alternative splicing results in two transcript variants encoding different isoforms. Other alternatively spliced transcripts have been described, but the full length sequences have not been determined. Several of these transcripts are predicted to encode truncated products which lack the TM and may be secreted. Mutations in this gene cause autosomal recessive polycystic kidney disease, also known as polycystic kidney and hepatic disease-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene display variable progressive liver cysts and fibrosis, but do not display kidney cysts and are fertile. Mice homozygous for a hypomorphic and null allele display renal, pancreatic, billiary and liver cysts. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd11 G A 5: 135,038,654 (GRCm39) C30Y probably benign Het
Akr1c20 C T 13: 4,562,671 (GRCm39) V95M probably damaging Het
Ano7 A G 1: 93,322,195 (GRCm39) D401G probably benign Het
Arhgef10l G A 4: 140,305,616 (GRCm39) T176I possibly damaging Het
Armc2 A C 10: 41,842,792 (GRCm39) V337G probably damaging Het
Atp6v0d2 T A 4: 19,922,400 (GRCm39) Y33F probably benign Het
Banp A G 8: 122,747,291 (GRCm39) S447G probably benign Het
Car8 T A 4: 8,238,860 (GRCm39) Y32F possibly damaging Het
Ccdc188 C T 16: 18,036,539 (GRCm39) P124S probably damaging Het
Cdc23 A T 18: 34,780,072 (GRCm39) D85E probably benign Het
Cnot6l T C 5: 96,242,084 (GRCm39) E213G possibly damaging Het
Cntnap4 A G 8: 113,484,113 (GRCm39) T389A probably benign Het
Cramp1 A T 17: 25,202,196 (GRCm39) C429S probably damaging Het
Crygn T C 5: 24,961,072 (GRCm39) H78R probably benign Het
D630003M21Rik T A 2: 158,059,588 (GRCm39) D104V probably damaging Het
Dcaf10 T G 4: 45,348,196 (GRCm39) H217Q probably damaging Het
Dmrtb1 C T 4: 107,541,179 (GRCm39) V61M probably benign Het
Dnai1 A G 4: 41,605,823 (GRCm39) E271G probably benign Het
Efr3a G A 15: 65,701,679 (GRCm39) V198I probably benign Het
Emsy G A 7: 98,289,060 (GRCm39) T79M probably damaging Het
Ergic1 A G 17: 26,853,449 (GRCm39) D145G probably damaging Het
Fah A G 7: 84,244,686 (GRCm39) V229A probably damaging Het
Fam76a G A 4: 132,629,342 (GRCm39) T270I probably damaging Het
Fat4 A T 3: 39,055,353 (GRCm39) M4191L probably benign Het
Fbxl22 G T 9: 66,418,999 (GRCm39) R213S probably benign Het
Fktn T C 4: 53,734,859 (GRCm39) F127L probably benign Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,436,769 (GRCm39) probably benign Het
Gabbr2 A T 4: 46,734,096 (GRCm39) S541T probably benign Het
Gm7489 A G 15: 53,749,402 (GRCm39) H158R unknown Het
Greb1l G C 18: 10,542,056 (GRCm39) E1268Q probably benign Het
H2-D1 A G 17: 35,482,848 (GRCm39) D126G probably damaging Het
Ikzf3 T A 11: 98,409,525 (GRCm39) T13S probably benign Het
Il23r T C 6: 67,400,846 (GRCm39) T495A probably benign Het
Insyn2b A G 11: 34,353,034 (GRCm39) T359A probably benign Het
Irf5 A G 6: 29,535,461 (GRCm39) T230A probably benign Het
Itga2b A T 11: 102,348,108 (GRCm39) I831N probably damaging Het
Itgb4 A G 11: 115,891,087 (GRCm39) D1168G probably damaging Het
Kcnma1 G T 14: 23,440,991 (GRCm39) P605Q probably benign Het
Larp7 A T 3: 127,337,916 (GRCm39) M381K possibly damaging Het
Lfng G A 5: 140,598,588 (GRCm39) G269D probably benign Het
Liph T C 16: 21,780,986 (GRCm39) I335V probably benign Het
Map2k2 A T 10: 80,954,040 (GRCm39) I169F possibly damaging Het
Mmrn1 T A 6: 60,964,044 (GRCm39) probably null Het
Nod2 A G 8: 89,387,425 (GRCm39) probably null Het
Or51ag1 A C 7: 103,155,586 (GRCm39) L189R probably damaging Het
Or5b101 T A 19: 13,005,360 (GRCm39) Y111F probably benign Het
Or9s23 T C 1: 92,501,219 (GRCm39) F109L probably benign Het
Pcdh20 G T 14: 88,707,143 (GRCm39) F52L probably null Het
Pla2r1 T A 2: 60,334,536 (GRCm39) D412V possibly damaging Het
Pole T G 5: 110,465,663 (GRCm39) M1197R probably benign Het
Pom121l2 C T 13: 22,168,048 (GRCm39) T773I possibly damaging Het
Ppp2r5d A T 17: 46,995,472 (GRCm39) M497K probably benign Het
Rbm45 G T 2: 76,206,797 (GRCm39) V270F possibly damaging Het
Ros1 A T 10: 52,020,957 (GRCm39) F673I probably damaging Het
Rtn4 T A 11: 29,691,048 (GRCm39) L1113* probably null Het
Scn4a A G 11: 106,212,841 (GRCm39) I1388T probably benign Het
Sema3c G A 5: 17,899,845 (GRCm39) V446I probably damaging Het
Six4 T C 12: 73,159,408 (GRCm39) Y176C probably damaging Het
Slc35a5 T A 16: 44,964,570 (GRCm39) K221M possibly damaging Het
Slc6a19 A G 13: 73,841,182 (GRCm39) I76T probably damaging Het
Slfn4 A G 11: 83,077,419 (GRCm39) D69G probably damaging Het
Smc6 T C 12: 11,367,844 (GRCm39) F1085L probably benign Het
Spatc1l A G 10: 76,398,224 (GRCm39) S9G probably benign Het
Stx8 T A 11: 68,000,106 (GRCm39) I182N probably damaging Het
Sult2a8 A T 7: 14,147,596 (GRCm39) C232S probably benign Het
Susd4 G A 1: 182,686,070 (GRCm39) A207T probably benign Het
Svep1 G A 4: 58,054,539 (GRCm39) P3350S probably benign Het
Tbx20 A T 9: 24,685,108 (GRCm39) S12T probably damaging Het
Tfrc A G 16: 32,437,985 (GRCm39) K346R probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Umodl1 A T 17: 31,192,666 (GRCm39) probably null Het
Vmn1r201 T C 13: 22,659,538 (GRCm39) F251L possibly damaging Het
Vmn1r230 A G 17: 21,066,933 (GRCm39) T41A probably benign Het
Vmn2r20 A G 6: 123,362,882 (GRCm39) L634P probably damaging Het
Vmn2r81 A T 10: 79,129,664 (GRCm39) R852W probably damaging Het
Wdr41 A T 13: 95,151,701 (GRCm39) N287I probably benign Het
Zfp202 A G 9: 40,121,758 (GRCm39) D285G possibly damaging Het
Other mutations in Pkhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Pkhd1 APN 1 20,637,098 (GRCm39) critical splice acceptor site probably null
IGL00687:Pkhd1 APN 1 20,594,294 (GRCm39) missense probably benign 0.19
IGL00824:Pkhd1 APN 1 20,151,408 (GRCm39) critical splice donor site probably null
IGL00870:Pkhd1 APN 1 20,641,614 (GRCm39) missense probably damaging 1.00
IGL00911:Pkhd1 APN 1 20,187,971 (GRCm39) missense probably benign 0.00
IGL01015:Pkhd1 APN 1 20,593,482 (GRCm39) missense possibly damaging 0.95
IGL01025:Pkhd1 APN 1 20,279,400 (GRCm39) missense probably benign 0.04
IGL01064:Pkhd1 APN 1 20,604,754 (GRCm39) splice site probably benign
IGL01313:Pkhd1 APN 1 20,271,248 (GRCm39) missense probably damaging 1.00
IGL01340:Pkhd1 APN 1 20,593,201 (GRCm39) missense probably benign 0.01
IGL01352:Pkhd1 APN 1 20,619,939 (GRCm39) missense probably benign 0.34
IGL01456:Pkhd1 APN 1 20,269,683 (GRCm39) missense probably damaging 1.00
IGL01530:Pkhd1 APN 1 20,629,643 (GRCm39) critical splice donor site probably null
IGL01557:Pkhd1 APN 1 20,187,203 (GRCm39) missense possibly damaging 0.59
IGL01655:Pkhd1 APN 1 20,604,857 (GRCm39) nonsense probably null
IGL01790:Pkhd1 APN 1 20,628,895 (GRCm39) missense probably damaging 0.96
IGL01862:Pkhd1 APN 1 20,429,134 (GRCm39) missense probably damaging 1.00
IGL01874:Pkhd1 APN 1 20,173,459 (GRCm39) missense probably benign 0.32
IGL01901:Pkhd1 APN 1 20,290,307 (GRCm39) missense probably benign 0.11
IGL01903:Pkhd1 APN 1 20,268,361 (GRCm39) missense probably damaging 1.00
IGL01981:Pkhd1 APN 1 20,593,791 (GRCm39) missense possibly damaging 0.64
IGL02068:Pkhd1 APN 1 20,592,971 (GRCm39) missense probably damaging 1.00
IGL02083:Pkhd1 APN 1 20,271,451 (GRCm39) missense probably damaging 1.00
IGL02084:Pkhd1 APN 1 20,447,623 (GRCm39) missense probably damaging 1.00
IGL02126:Pkhd1 APN 1 20,187,419 (GRCm39) missense probably damaging 1.00
IGL02136:Pkhd1 APN 1 20,345,839 (GRCm39) missense probably damaging 1.00
IGL02255:Pkhd1 APN 1 20,654,325 (GRCm39) missense probably damaging 1.00
IGL02272:Pkhd1 APN 1 20,279,484 (GRCm39) missense probably damaging 1.00
IGL02308:Pkhd1 APN 1 20,140,600 (GRCm39) critical splice donor site probably null
IGL02364:Pkhd1 APN 1 20,271,007 (GRCm39) missense probably benign
IGL02389:Pkhd1 APN 1 20,187,944 (GRCm39) missense probably damaging 0.99
IGL02394:Pkhd1 APN 1 20,269,710 (GRCm39) missense possibly damaging 0.57
IGL02403:Pkhd1 APN 1 20,632,642 (GRCm39) missense probably benign 0.01
IGL02415:Pkhd1 APN 1 20,484,645 (GRCm39) missense probably damaging 1.00
IGL02415:Pkhd1 APN 1 20,592,983 (GRCm39) missense probably damaging 1.00
IGL02455:Pkhd1 APN 1 20,434,425 (GRCm39) missense probably damaging 1.00
IGL02502:Pkhd1 APN 1 20,462,389 (GRCm39) missense probably damaging 1.00
IGL02511:Pkhd1 APN 1 20,143,731 (GRCm39) missense possibly damaging 0.90
IGL02530:Pkhd1 APN 1 20,187,944 (GRCm39) missense probably damaging 0.99
IGL02532:Pkhd1 APN 1 20,187,944 (GRCm39) missense probably damaging 0.99
IGL02534:Pkhd1 APN 1 20,187,944 (GRCm39) missense probably damaging 0.99
IGL02556:Pkhd1 APN 1 20,380,934 (GRCm39) missense probably damaging 1.00
IGL02570:Pkhd1 APN 1 20,590,480 (GRCm39) missense probably damaging 0.99
IGL02605:Pkhd1 APN 1 20,621,126 (GRCm39) missense possibly damaging 0.66
IGL02641:Pkhd1 APN 1 20,628,976 (GRCm39) missense possibly damaging 0.61
IGL02741:Pkhd1 APN 1 20,290,253 (GRCm39) splice site probably benign
IGL02752:Pkhd1 APN 1 20,623,815 (GRCm39) missense possibly damaging 0.57
IGL02890:Pkhd1 APN 1 20,431,235 (GRCm39) missense probably damaging 1.00
IGL02959:Pkhd1 APN 1 20,678,640 (GRCm39) nonsense probably null
IGL02960:Pkhd1 APN 1 20,447,670 (GRCm39) missense possibly damaging 0.69
IGL02990:Pkhd1 APN 1 20,593,187 (GRCm39) missense possibly damaging 0.52
IGL03037:Pkhd1 APN 1 20,592,923 (GRCm39) missense probably benign 0.06
IGL03082:Pkhd1 APN 1 20,635,857 (GRCm39) missense probably damaging 1.00
IGL03114:Pkhd1 APN 1 20,268,395 (GRCm39) missense probably damaging 0.99
IGL03288:Pkhd1 APN 1 20,271,243 (GRCm39) missense probably benign 0.01
IGL03328:Pkhd1 APN 1 20,151,524 (GRCm39) splice site probably benign
IGL03375:Pkhd1 APN 1 20,187,247 (GRCm39) missense probably damaging 1.00
IGL03380:Pkhd1 APN 1 20,270,894 (GRCm39) missense probably damaging 1.00
0152:Pkhd1 UTSW 1 20,593,118 (GRCm39) missense possibly damaging 0.46
IGL03046:Pkhd1 UTSW 1 20,607,589 (GRCm39) missense possibly damaging 0.81
LCD18:Pkhd1 UTSW 1 20,681,638 (GRCm39) intron probably benign
P0035:Pkhd1 UTSW 1 20,187,571 (GRCm39) missense probably benign 0.00
PIT4260001:Pkhd1 UTSW 1 20,293,130 (GRCm39) missense possibly damaging 0.51
R0063:Pkhd1 UTSW 1 20,282,174 (GRCm39) missense probably benign 0.02
R0063:Pkhd1 UTSW 1 20,282,174 (GRCm39) missense probably benign 0.02
R0071:Pkhd1 UTSW 1 20,271,568 (GRCm39) missense probably benign 0.11
R0071:Pkhd1 UTSW 1 20,271,568 (GRCm39) missense probably benign 0.11
R0094:Pkhd1 UTSW 1 20,279,470 (GRCm39) missense probably damaging 1.00
R0094:Pkhd1 UTSW 1 20,279,470 (GRCm39) missense probably damaging 1.00
R0103:Pkhd1 UTSW 1 20,593,583 (GRCm39) missense probably benign 0.04
R0103:Pkhd1 UTSW 1 20,593,583 (GRCm39) missense probably benign 0.04
R0105:Pkhd1 UTSW 1 20,593,956 (GRCm39) nonsense probably null
R0105:Pkhd1 UTSW 1 20,593,956 (GRCm39) nonsense probably null
R0115:Pkhd1 UTSW 1 20,420,714 (GRCm39) missense probably damaging 1.00
R0193:Pkhd1 UTSW 1 20,429,141 (GRCm39) missense probably damaging 1.00
R0245:Pkhd1 UTSW 1 20,610,624 (GRCm39) missense probably benign 0.03
R0277:Pkhd1 UTSW 1 20,345,762 (GRCm39) missense probably benign 0.04
R0310:Pkhd1 UTSW 1 20,620,046 (GRCm39) splice site probably null
R0323:Pkhd1 UTSW 1 20,345,762 (GRCm39) missense probably benign 0.04
R0395:Pkhd1 UTSW 1 20,451,771 (GRCm39) missense probably benign 0.26
R0412:Pkhd1 UTSW 1 20,188,012 (GRCm39) missense probably damaging 1.00
R0506:Pkhd1 UTSW 1 20,629,693 (GRCm39) missense probably benign 0.00
R0512:Pkhd1 UTSW 1 20,380,738 (GRCm39) splice site probably benign
R0550:Pkhd1 UTSW 1 20,417,447 (GRCm39) missense probably null 1.00
R0584:Pkhd1 UTSW 1 20,309,660 (GRCm39) nonsense probably null
R0586:Pkhd1 UTSW 1 20,594,335 (GRCm39) missense probably benign 0.04
R0598:Pkhd1 UTSW 1 20,271,114 (GRCm39) missense probably damaging 1.00
R0603:Pkhd1 UTSW 1 20,187,397 (GRCm39) missense probably benign 0.05
R0634:Pkhd1 UTSW 1 20,187,698 (GRCm39) missense probably damaging 1.00
R0677:Pkhd1 UTSW 1 20,594,454 (GRCm39) missense probably benign 0.01
R0746:Pkhd1 UTSW 1 20,268,331 (GRCm39) missense probably damaging 1.00
R0781:Pkhd1 UTSW 1 20,187,708 (GRCm39) missense probably benign 0.01
R0840:Pkhd1 UTSW 1 20,420,745 (GRCm39) missense probably damaging 0.98
R0946:Pkhd1 UTSW 1 20,269,605 (GRCm39) missense probably benign 0.10
R1018:Pkhd1 UTSW 1 20,271,483 (GRCm39) missense possibly damaging 0.89
R1028:Pkhd1 UTSW 1 20,187,950 (GRCm39) missense probably damaging 1.00
R1136:Pkhd1 UTSW 1 20,593,053 (GRCm39) missense possibly damaging 0.68
R1178:Pkhd1 UTSW 1 20,655,381 (GRCm39) critical splice donor site probably null
R1180:Pkhd1 UTSW 1 20,655,381 (GRCm39) critical splice donor site probably null
R1222:Pkhd1 UTSW 1 20,637,680 (GRCm39) missense probably benign 0.07
R1334:Pkhd1 UTSW 1 20,604,129 (GRCm39) missense possibly damaging 0.81
R1335:Pkhd1 UTSW 1 20,641,629 (GRCm39) missense probably damaging 1.00
R1387:Pkhd1 UTSW 1 20,625,447 (GRCm39) splice site probably benign
R1411:Pkhd1 UTSW 1 20,444,120 (GRCm39) missense probably damaging 1.00
R1443:Pkhd1 UTSW 1 20,604,782 (GRCm39) missense probably damaging 1.00
R1448:Pkhd1 UTSW 1 20,655,381 (GRCm39) critical splice donor site probably null
R1468:Pkhd1 UTSW 1 20,593,565 (GRCm39) missense probably damaging 1.00
R1468:Pkhd1 UTSW 1 20,593,565 (GRCm39) missense probably damaging 1.00
R1473:Pkhd1 UTSW 1 20,593,207 (GRCm39) missense probably benign 0.00
R1524:Pkhd1 UTSW 1 20,188,004 (GRCm39) missense probably damaging 1.00
R1532:Pkhd1 UTSW 1 20,187,625 (GRCm39) missense probably benign 0.08
R1565:Pkhd1 UTSW 1 20,417,681 (GRCm39) missense probably damaging 1.00
R1572:Pkhd1 UTSW 1 20,417,664 (GRCm39) missense probably benign 0.02
R1583:Pkhd1 UTSW 1 20,188,049 (GRCm39) missense probably benign
R1617:Pkhd1 UTSW 1 20,268,274 (GRCm39) missense possibly damaging 0.95
R1631:Pkhd1 UTSW 1 20,593,121 (GRCm39) missense probably benign 0.06
R1655:Pkhd1 UTSW 1 20,654,353 (GRCm39) missense probably damaging 1.00
R1707:Pkhd1 UTSW 1 20,621,064 (GRCm39) splice site probably benign
R1753:Pkhd1 UTSW 1 20,604,129 (GRCm39) missense possibly damaging 0.81
R1782:Pkhd1 UTSW 1 20,635,935 (GRCm39) missense probably damaging 0.98
R1791:Pkhd1 UTSW 1 20,655,376 (GRCm39) splice site probably benign
R1822:Pkhd1 UTSW 1 20,417,681 (GRCm39) missense probably damaging 1.00
R1823:Pkhd1 UTSW 1 20,417,681 (GRCm39) missense probably damaging 1.00
R1824:Pkhd1 UTSW 1 20,417,681 (GRCm39) missense probably damaging 1.00
R1836:Pkhd1 UTSW 1 20,187,293 (GRCm39) missense probably benign 0.01
R1862:Pkhd1 UTSW 1 20,621,244 (GRCm39) missense probably benign 0.00
R1863:Pkhd1 UTSW 1 20,621,244 (GRCm39) missense probably benign 0.00
R1869:Pkhd1 UTSW 1 20,685,491 (GRCm39) critical splice donor site probably null
R1913:Pkhd1 UTSW 1 20,636,980 (GRCm39) critical splice donor site probably null
R1928:Pkhd1 UTSW 1 20,151,524 (GRCm39) splice site probably benign
R1969:Pkhd1 UTSW 1 20,451,747 (GRCm39) missense probably damaging 1.00
R1970:Pkhd1 UTSW 1 20,451,747 (GRCm39) missense probably damaging 1.00
R1981:Pkhd1 UTSW 1 20,187,284 (GRCm39) missense probably benign 0.00
R2008:Pkhd1 UTSW 1 20,269,683 (GRCm39) missense probably damaging 0.99
R2034:Pkhd1 UTSW 1 20,270,893 (GRCm39) missense probably damaging 1.00
R2061:Pkhd1 UTSW 1 20,683,036 (GRCm39) missense possibly damaging 0.76
R2062:Pkhd1 UTSW 1 20,271,559 (GRCm39) missense probably damaging 0.97
R2108:Pkhd1 UTSW 1 20,623,798 (GRCm39) nonsense probably null
R2142:Pkhd1 UTSW 1 20,594,119 (GRCm39) missense probably benign 0.00
R2148:Pkhd1 UTSW 1 20,484,444 (GRCm39) critical splice donor site probably null
R2176:Pkhd1 UTSW 1 20,623,741 (GRCm39) missense probably damaging 1.00
R2202:Pkhd1 UTSW 1 20,607,584 (GRCm39) missense probably benign 0.06
R2255:Pkhd1 UTSW 1 20,635,863 (GRCm39) missense probably benign 0.23
R2269:Pkhd1 UTSW 1 20,604,759 (GRCm39) critical splice donor site probably null
R2275:Pkhd1 UTSW 1 20,271,073 (GRCm39) missense possibly damaging 0.95
R2340:Pkhd1 UTSW 1 20,271,079 (GRCm39) missense probably damaging 1.00
R2431:Pkhd1 UTSW 1 20,271,389 (GRCm39) missense possibly damaging 0.63
R2679:Pkhd1 UTSW 1 20,279,406 (GRCm39) missense probably benign 0.03
R2850:Pkhd1 UTSW 1 20,579,300 (GRCm39) missense possibly damaging 0.89
R2851:Pkhd1 UTSW 1 20,128,526 (GRCm39) missense probably benign 0.16
R2853:Pkhd1 UTSW 1 20,128,526 (GRCm39) missense probably benign 0.16
R2984:Pkhd1 UTSW 1 20,293,185 (GRCm39) missense possibly damaging 0.84
R2987:Pkhd1 UTSW 1 20,174,823 (GRCm39) missense possibly damaging 0.87
R3692:Pkhd1 UTSW 1 20,625,353 (GRCm39) missense possibly damaging 0.87
R3721:Pkhd1 UTSW 1 20,655,879 (GRCm39) missense probably benign 0.08
R3746:Pkhd1 UTSW 1 20,128,524 (GRCm39) makesense probably null
R3838:Pkhd1 UTSW 1 20,604,853 (GRCm39) missense possibly damaging 0.66
R3843:Pkhd1 UTSW 1 20,628,947 (GRCm39) missense probably benign 0.00
R3861:Pkhd1 UTSW 1 20,271,151 (GRCm39) missense probably damaging 1.00
R3893:Pkhd1 UTSW 1 20,382,362 (GRCm39) nonsense probably null
R3926:Pkhd1 UTSW 1 20,621,097 (GRCm39) missense probably benign 0.00
R4183:Pkhd1 UTSW 1 20,188,031 (GRCm39) missense probably benign 0.03
R4184:Pkhd1 UTSW 1 20,633,910 (GRCm39) missense probably benign 0.06
R4184:Pkhd1 UTSW 1 20,279,501 (GRCm39) missense probably benign 0.03
R4255:Pkhd1 UTSW 1 20,664,158 (GRCm39) missense probably damaging 0.99
R4275:Pkhd1 UTSW 1 20,128,608 (GRCm39) missense probably benign 0.00
R4342:Pkhd1 UTSW 1 20,128,841 (GRCm39) missense probably benign 0.00
R4386:Pkhd1 UTSW 1 20,484,516 (GRCm39) missense probably benign 0.00
R4402:Pkhd1 UTSW 1 20,309,635 (GRCm39) missense probably damaging 1.00
R4431:Pkhd1 UTSW 1 20,593,538 (GRCm39) missense probably damaging 0.99
R4560:Pkhd1 UTSW 1 20,282,082 (GRCm39) missense probably damaging 1.00
R4561:Pkhd1 UTSW 1 20,604,943 (GRCm39) missense possibly damaging 0.89
R4570:Pkhd1 UTSW 1 20,451,747 (GRCm39) missense probably damaging 1.00
R4571:Pkhd1 UTSW 1 20,683,633 (GRCm39) missense probably damaging 1.00
R4588:Pkhd1 UTSW 1 20,271,092 (GRCm39) missense probably benign 0.00
R4598:Pkhd1 UTSW 1 20,573,280 (GRCm39) missense probably damaging 1.00
R4651:Pkhd1 UTSW 1 20,451,747 (GRCm39) missense probably damaging 1.00
R4657:Pkhd1 UTSW 1 20,434,391 (GRCm39) missense possibly damaging 0.89
R4718:Pkhd1 UTSW 1 20,151,452 (GRCm39) missense probably damaging 1.00
R4740:Pkhd1 UTSW 1 20,594,354 (GRCm39) missense probably benign
R4750:Pkhd1 UTSW 1 20,594,336 (GRCm39) missense possibly damaging 0.57
R4816:Pkhd1 UTSW 1 20,269,639 (GRCm39) missense probably damaging 0.99
R4825:Pkhd1 UTSW 1 20,607,625 (GRCm39) missense probably damaging 0.96
R4885:Pkhd1 UTSW 1 20,140,712 (GRCm39) missense possibly damaging 0.55
R4907:Pkhd1 UTSW 1 20,279,450 (GRCm39) missense probably damaging 1.00
R4944:Pkhd1 UTSW 1 20,358,429 (GRCm39) missense probably null 0.01
R5062:Pkhd1 UTSW 1 20,655,935 (GRCm39) missense probably benign 0.00
R5090:Pkhd1 UTSW 1 20,270,981 (GRCm39) missense probably damaging 1.00
R5104:Pkhd1 UTSW 1 20,655,415 (GRCm39) missense probably damaging 1.00
R5187:Pkhd1 UTSW 1 20,279,448 (GRCm39) missense possibly damaging 0.67
R5202:Pkhd1 UTSW 1 20,617,565 (GRCm39) missense probably benign 0.01
R5240:Pkhd1 UTSW 1 20,345,865 (GRCm39) missense probably benign 0.04
R5248:Pkhd1 UTSW 1 20,604,769 (GRCm39) missense probably benign 0.00
R5252:Pkhd1 UTSW 1 20,420,635 (GRCm39) critical splice donor site probably null
R5293:Pkhd1 UTSW 1 20,579,300 (GRCm39) missense possibly damaging 0.89
R5311:Pkhd1 UTSW 1 20,636,094 (GRCm39) missense possibly damaging 0.94
R5317:Pkhd1 UTSW 1 20,520,528 (GRCm39) missense probably damaging 1.00
R5346:Pkhd1 UTSW 1 20,593,658 (GRCm39) missense probably damaging 0.96
R5346:Pkhd1 UTSW 1 20,462,321 (GRCm39) missense probably benign
R5431:Pkhd1 UTSW 1 20,188,060 (GRCm39) missense probably benign 0.25
R5447:Pkhd1 UTSW 1 20,309,609 (GRCm39) missense probably benign 0.00
R5478:Pkhd1 UTSW 1 20,271,380 (GRCm39) missense probably damaging 1.00
R5497:Pkhd1 UTSW 1 20,447,628 (GRCm39) missense possibly damaging 0.94
R5554:Pkhd1 UTSW 1 20,151,476 (GRCm39) missense probably damaging 0.99
R5579:Pkhd1 UTSW 1 20,593,366 (GRCm39) missense probably damaging 0.96
R5614:Pkhd1 UTSW 1 20,143,750 (GRCm39) missense possibly damaging 0.83
R5648:Pkhd1 UTSW 1 20,628,850 (GRCm39) missense probably benign 0.04
R5651:Pkhd1 UTSW 1 20,188,031 (GRCm39) missense probably benign 0.03
R5665:Pkhd1 UTSW 1 20,658,755 (GRCm39) missense probably damaging 1.00
R5681:Pkhd1 UTSW 1 20,617,685 (GRCm39) missense possibly damaging 0.61
R5754:Pkhd1 UTSW 1 20,593,875 (GRCm39) nonsense probably null
R5760:Pkhd1 UTSW 1 20,143,778 (GRCm39) missense probably benign 0.02
R5776:Pkhd1 UTSW 1 20,279,409 (GRCm39) missense possibly damaging 0.62
R5782:Pkhd1 UTSW 1 20,128,824 (GRCm39) missense probably benign
R5810:Pkhd1 UTSW 1 20,270,897 (GRCm39) missense probably benign 0.26
R5814:Pkhd1 UTSW 1 20,269,629 (GRCm39) missense probably damaging 1.00
R5816:Pkhd1 UTSW 1 20,128,902 (GRCm39) missense probably benign 0.03
R5835:Pkhd1 UTSW 1 20,271,307 (GRCm39) missense probably benign 0.01
R5844:Pkhd1 UTSW 1 20,451,685 (GRCm39) missense probably benign 0.00
R5847:Pkhd1 UTSW 1 20,444,960 (GRCm39) nonsense probably null
R5852:Pkhd1 UTSW 1 20,447,632 (GRCm39) missense probably benign 0.22
R5863:Pkhd1 UTSW 1 20,590,434 (GRCm39) missense possibly damaging 0.63
R6213:Pkhd1 UTSW 1 20,593,994 (GRCm39) missense possibly damaging 0.80
R6351:Pkhd1 UTSW 1 20,282,175 (GRCm39) missense probably benign 0.00
R6386:Pkhd1 UTSW 1 20,621,244 (GRCm39) missense probably damaging 0.96
R6542:Pkhd1 UTSW 1 20,655,927 (GRCm39) missense probably benign 0.02
R6579:Pkhd1 UTSW 1 20,271,047 (GRCm39) missense probably benign 0.01
R6658:Pkhd1 UTSW 1 20,682,929 (GRCm39) missense probably damaging 1.00
R6765:Pkhd1 UTSW 1 20,128,563 (GRCm39) missense probably benign
R6886:Pkhd1 UTSW 1 20,417,504 (GRCm39) missense probably benign 0.01
R6892:Pkhd1 UTSW 1 20,593,739 (GRCm39) missense probably damaging 1.00
R6900:Pkhd1 UTSW 1 20,604,925 (GRCm39) missense probably benign 0.06
R6932:Pkhd1 UTSW 1 20,632,675 (GRCm39) missense probably benign 0.19
R7191:Pkhd1 UTSW 1 20,628,943 (GRCm39) missense probably benign 0.00
R7220:Pkhd1 UTSW 1 20,593,350 (GRCm39) missense possibly damaging 0.89
R7329:Pkhd1 UTSW 1 20,617,743 (GRCm39) missense probably damaging 0.96
R7361:Pkhd1 UTSW 1 20,664,177 (GRCm39) missense probably damaging 1.00
R7381:Pkhd1 UTSW 1 20,271,197 (GRCm39) missense probably damaging 1.00
R7388:Pkhd1 UTSW 1 20,309,528 (GRCm39) missense not run
R7436:Pkhd1 UTSW 1 20,270,925 (GRCm39) missense probably benign
R7473:Pkhd1 UTSW 1 20,619,980 (GRCm39) missense probably damaging 0.99
R7578:Pkhd1 UTSW 1 20,417,585 (GRCm39) missense probably damaging 1.00
R7751:Pkhd1 UTSW 1 20,271,149 (GRCm39) missense probably damaging 1.00
R7755:Pkhd1 UTSW 1 20,617,717 (GRCm39) missense probably damaging 0.98
R7757:Pkhd1 UTSW 1 20,632,639 (GRCm39) missense probably damaging 1.00
R7834:Pkhd1 UTSW 1 20,382,273 (GRCm39) missense probably benign
R7920:Pkhd1 UTSW 1 20,345,759 (GRCm39) missense probably damaging 1.00
R8014:Pkhd1 UTSW 1 20,579,115 (GRCm39) critical splice donor site probably null
R8034:Pkhd1 UTSW 1 20,451,662 (GRCm39) missense possibly damaging 0.94
R8085:Pkhd1 UTSW 1 20,683,639 (GRCm39) missense probably damaging 1.00
R8087:Pkhd1 UTSW 1 20,593,313 (GRCm39) missense probably damaging 1.00
R8103:Pkhd1 UTSW 1 20,270,981 (GRCm39) missense probably damaging 1.00
R8122:Pkhd1 UTSW 1 20,632,682 (GRCm39) missense probably damaging 1.00
R8273:Pkhd1 UTSW 1 20,607,644 (GRCm39) splice site probably benign
R8485:Pkhd1 UTSW 1 20,593,257 (GRCm39) missense probably damaging 1.00
R8504:Pkhd1 UTSW 1 20,590,432 (GRCm39) missense probably benign 0.10
R8544:Pkhd1 UTSW 1 20,593,199 (GRCm39) missense probably damaging 1.00
R8692:Pkhd1 UTSW 1 20,462,374 (GRCm39) missense probably damaging 1.00
R8787:Pkhd1 UTSW 1 20,358,461 (GRCm39) missense probably damaging 0.99
R8853:Pkhd1 UTSW 1 20,143,679 (GRCm39) critical splice donor site probably null
R8907:Pkhd1 UTSW 1 20,187,785 (GRCm39) missense possibly damaging 0.88
R8934:Pkhd1 UTSW 1 20,462,234 (GRCm39) critical splice donor site probably null
R8990:Pkhd1 UTSW 1 20,417,529 (GRCm39) missense probably benign 0.00
R8998:Pkhd1 UTSW 1 20,434,425 (GRCm39) missense probably damaging 1.00
R9024:Pkhd1 UTSW 1 20,592,975 (GRCm39) missense probably benign 0.24
R9035:Pkhd1 UTSW 1 20,573,176 (GRCm39) missense probably damaging 1.00
R9092:Pkhd1 UTSW 1 20,632,586 (GRCm39) missense probably benign 0.00
R9238:Pkhd1 UTSW 1 20,604,799 (GRCm39) missense possibly damaging 0.89
R9258:Pkhd1 UTSW 1 20,444,174 (GRCm39) missense probably damaging 0.99
R9262:Pkhd1 UTSW 1 20,618,351 (GRCm39) missense probably benign 0.01
R9297:Pkhd1 UTSW 1 20,293,118 (GRCm39) missense probably benign 0.06
R9452:Pkhd1 UTSW 1 20,682,953 (GRCm39) missense possibly damaging 0.77
R9515:Pkhd1 UTSW 1 20,637,741 (GRCm39) missense probably damaging 1.00
R9540:Pkhd1 UTSW 1 20,269,570 (GRCm39) missense probably benign 0.00
R9542:Pkhd1 UTSW 1 20,188,004 (GRCm39) missense probably damaging 1.00
R9629:Pkhd1 UTSW 1 20,462,437 (GRCm39) missense possibly damaging 0.63
R9644:Pkhd1 UTSW 1 20,617,690 (GRCm39) missense probably benign 0.04
R9739:Pkhd1 UTSW 1 20,420,708 (GRCm39) missense probably damaging 1.00
R9767:Pkhd1 UTSW 1 20,484,636 (GRCm39) missense probably benign
R9781:Pkhd1 UTSW 1 20,187,665 (GRCm39) missense possibly damaging 0.95
R9803:Pkhd1 UTSW 1 20,637,073 (GRCm39) missense probably damaging 1.00
X0012:Pkhd1 UTSW 1 20,444,150 (GRCm39) missense probably damaging 1.00
X0067:Pkhd1 UTSW 1 20,590,450 (GRCm39) missense probably damaging 1.00
Z1176:Pkhd1 UTSW 1 20,593,971 (GRCm39) missense possibly damaging 0.81
Z1177:Pkhd1 UTSW 1 20,593,845 (GRCm39) missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20,380,818 (GRCm39) missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20,188,107 (GRCm39) missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20,621,243 (GRCm39) missense probably benign
Z1177:Pkhd1 UTSW 1 20,594,162 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCCCTCAAAGATGGAGAG -3'
(R):5'- AATGGTGGCCTCTAGTTGC -3'

Sequencing Primer
(F):5'- TGCTGCCATTTGGACTA -3'
(R):5'- CTCTAGTTGCCACAAGCTAATGG -3'
Posted On 2019-12-20