Incidental Mutation 'R7832:D630003M21Rik'
ID605678
Institutional Source Beutler Lab
Gene Symbol D630003M21Rik
Ensembl Gene ENSMUSG00000037813
Gene NameRIKEN cDNA D630003M21 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7832 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location158182533-158229222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 158217668 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 104 (D104V)
Ref Sequence ENSEMBL: ENSMUSP00000040546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046944] [ENSMUST00000103121] [ENSMUST00000169335]
Predicted Effect probably damaging
Transcript: ENSMUST00000046944
AA Change: D104V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040546
Gene: ENSMUSG00000037813
AA Change: D104V

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 1e-6 BLAST
SCOP:d1aua_2 567 711 5e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1160 1174 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103121
AA Change: D104V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099410
Gene: ENSMUSG00000037813
AA Change: D104V

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 7e-7 BLAST
SCOP:d1aua_2 567 711 4e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169335
AA Change: D104V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130623
Gene: ENSMUSG00000037813
AA Change: D104V

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 7e-7 BLAST
SCOP:d1aua_2 567 711 4e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (78/80)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd11 G A 5: 135,009,800 C30Y probably benign Het
Akr1c20 C T 13: 4,512,672 V95M probably damaging Het
Ano7 A G 1: 93,394,473 D401G probably benign Het
Arhgef10l G A 4: 140,578,305 T176I possibly damaging Het
Armc2 A C 10: 41,966,796 V337G probably damaging Het
Atp6v0d2 T A 4: 19,922,400 Y33F probably benign Het
Banp A G 8: 122,020,552 S447G probably benign Het
Car8 T A 4: 8,238,860 Y32F possibly damaging Het
Ccdc188 C T 16: 18,218,675 P124S probably damaging Het
Cdc23 A T 18: 34,647,019 D85E probably benign Het
Cnot6l T C 5: 96,094,225 E213G possibly damaging Het
Cntnap4 A G 8: 112,757,481 T389A probably benign Het
Cramp1l A T 17: 24,983,222 C429S probably damaging Het
Crygn T C 5: 24,756,074 H78R probably benign Het
Dcaf10 T G 4: 45,348,196 H217Q probably damaging Het
Dmrtb1 C T 4: 107,683,982 V61M probably benign Het
Dnaic1 A G 4: 41,605,823 E271G probably benign Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Emsy G A 7: 98,639,853 T79M probably damaging Het
Ergic1 A G 17: 26,634,475 D145G probably damaging Het
Fah A G 7: 84,595,478 V229A probably damaging Het
Fam196b A G 11: 34,403,034 T359A probably benign Het
Fam76a G A 4: 132,902,031 T270I probably damaging Het
Fat4 A T 3: 39,001,204 M4191L probably benign Het
Fbxl22 G T 9: 66,511,717 R213S probably benign Het
Fktn T C 4: 53,734,859 F127L probably benign Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Gabbr2 A T 4: 46,734,096 S541T probably benign Het
Gm7489 A G 15: 53,886,006 H158R unknown Het
Greb1l G C 18: 10,542,056 E1268Q probably benign Het
H2-D1 A G 17: 35,263,872 D126G probably damaging Het
Ikzf3 T A 11: 98,518,699 T13S probably benign Het
Il23r T C 6: 67,423,862 T495A probably benign Het
Irf5 A G 6: 29,535,462 T230A probably benign Het
Itga2b A T 11: 102,457,282 I831N probably damaging Het
Itgb4 A G 11: 116,000,261 D1168G probably damaging Het
Kcnma1 G T 14: 23,390,923 P605Q probably benign Het
Larp7 A T 3: 127,544,267 M381K possibly damaging Het
Lfng G A 5: 140,612,833 G269D probably benign Het
Liph T C 16: 21,962,236 I335V probably benign Het
Map2k2 A T 10: 81,118,206 I169F possibly damaging Het
Mmrn1 T A 6: 60,987,060 probably null Het
Nod2 A G 8: 88,660,797 probably null Het
Olfr1413 T C 1: 92,573,497 F109L probably benign Het
Olfr1453 T A 19: 13,027,996 Y111F probably benign Het
Olfr610 A C 7: 103,506,379 L189R probably damaging Het
Pcdh20 G T 14: 88,469,707 F52L probably null Het
Pkhd1 A T 1: 20,502,999 N1894K probably damaging Het
Pla2r1 T A 2: 60,504,192 D412V possibly damaging Het
Pole T G 5: 110,317,797 M1197R probably benign Het
Pom121l2 C T 13: 21,983,878 T773I possibly damaging Het
Ppp2r5d A T 17: 46,684,546 M497K probably benign Het
Rbm45 G T 2: 76,376,453 V270F possibly damaging Het
Ros1 A T 10: 52,144,861 F673I probably damaging Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Scn4a A G 11: 106,322,015 I1388T probably benign Het
Sema3c G A 5: 17,694,847 V446I probably damaging Het
Six4 T C 12: 73,112,634 Y176C probably damaging Het
Slc35a5 T A 16: 45,144,207 K221M possibly damaging Het
Slc6a19 A G 13: 73,693,063 I76T probably damaging Het
Slfn4 A G 11: 83,186,593 D69G probably damaging Het
Smc6 T C 12: 11,317,843 F1085L probably benign Het
Spatc1l A G 10: 76,562,390 S9G probably benign Het
Stx8 T A 11: 68,109,280 I182N probably damaging Het
Sult2a8 A T 7: 14,413,671 C232S probably benign Het
Susd4 G A 1: 182,858,505 A207T probably benign Het
Svep1 G A 4: 58,054,539 P3350S probably benign Het
Tbx20 A T 9: 24,773,812 S12T probably damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Umodl1 A T 17: 30,973,692 probably null Het
Vmn1r201 T C 13: 22,475,368 F251L possibly damaging Het
Vmn1r230 A G 17: 20,846,671 T41A probably benign Het
Vmn2r20 A G 6: 123,385,923 L634P probably damaging Het
Vmn2r81 A T 10: 79,293,830 R852W probably damaging Het
Wdr41 A T 13: 95,015,193 N287I probably benign Het
Zfp202 A G 9: 40,210,462 D285G possibly damaging Het
Other mutations in D630003M21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:D630003M21Rik APN 2 158213412 missense possibly damaging 0.92
IGL01447:D630003M21Rik APN 2 158217356 missense probably benign
IGL01501:D630003M21Rik APN 2 158201067 missense probably benign 0.03
IGL01874:D630003M21Rik APN 2 158204724 missense probably damaging 1.00
IGL02116:D630003M21Rik APN 2 158203210 missense possibly damaging 0.76
IGL02212:D630003M21Rik APN 2 158210171 missense probably benign 0.02
IGL02477:D630003M21Rik APN 2 158217488 missense probably benign 0.44
IGL02644:D630003M21Rik APN 2 158216810 missense possibly damaging 0.87
IGL02861:D630003M21Rik APN 2 158200998 missense probably benign 0.03
IGL02896:D630003M21Rik APN 2 158217285 missense probably benign 0.00
IGL03089:D630003M21Rik APN 2 158216744 missense probably benign
IGL03148:D630003M21Rik APN 2 158217224 missense probably damaging 1.00
ANU05:D630003M21Rik UTSW 2 158196388 missense probably benign 0.00
ANU18:D630003M21Rik UTSW 2 158217648 missense probably benign
F5770:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
R0113:D630003M21Rik UTSW 2 158196575 missense possibly damaging 0.92
R0147:D630003M21Rik UTSW 2 158203067 splice site probably benign
R0513:D630003M21Rik UTSW 2 158200308 missense probably benign 0.44
R0637:D630003M21Rik UTSW 2 158195407 intron probably benign
R1594:D630003M21Rik UTSW 2 158211630 missense probably damaging 1.00
R1774:D630003M21Rik UTSW 2 158220470 missense probably damaging 1.00
R1823:D630003M21Rik UTSW 2 158217557 missense probably damaging 1.00
R1864:D630003M21Rik UTSW 2 158203185 missense probably damaging 1.00
R1983:D630003M21Rik UTSW 2 158208421 missense probably benign 0.34
R2042:D630003M21Rik UTSW 2 158215849 missense probably damaging 1.00
R2259:D630003M21Rik UTSW 2 158204711 missense probably damaging 1.00
R2350:D630003M21Rik UTSW 2 158201011 missense probably damaging 0.96
R3157:D630003M21Rik UTSW 2 158195472 intron probably benign
R3937:D630003M21Rik UTSW 2 158200360 missense probably damaging 1.00
R4124:D630003M21Rik UTSW 2 158196593 missense probably damaging 0.97
R4437:D630003M21Rik UTSW 2 158213462 missense probably damaging 1.00
R4473:D630003M21Rik UTSW 2 158213462 missense probably damaging 1.00
R4513:D630003M21Rik UTSW 2 158204802 missense probably benign 0.01
R4514:D630003M21Rik UTSW 2 158204802 missense probably benign 0.01
R4729:D630003M21Rik UTSW 2 158216703 missense probably damaging 1.00
R4794:D630003M21Rik UTSW 2 158196139 missense probably benign
R4947:D630003M21Rik UTSW 2 158186196 missense unknown
R5005:D630003M21Rik UTSW 2 158211643 missense possibly damaging 0.87
R5022:D630003M21Rik UTSW 2 158217633 missense probably damaging 0.99
R5167:D630003M21Rik UTSW 2 158205745 missense probably damaging 1.00
R5191:D630003M21Rik UTSW 2 158201035 missense probably benign 0.06
R5488:D630003M21Rik UTSW 2 158217021 missense probably benign 0.15
R5489:D630003M21Rik UTSW 2 158217021 missense probably benign 0.15
R5495:D630003M21Rik UTSW 2 158220511 missense possibly damaging 0.69
R5708:D630003M21Rik UTSW 2 158220392 splice site probably null
R5770:D630003M21Rik UTSW 2 158195580 intron probably benign
R5789:D630003M21Rik UTSW 2 158216814 missense possibly damaging 0.63
R5817:D630003M21Rik UTSW 2 158196493 missense probably damaging 1.00
R5898:D630003M21Rik UTSW 2 158204657 splice site probably null
R5969:D630003M21Rik UTSW 2 158217708 missense probably damaging 1.00
R6084:D630003M21Rik UTSW 2 158217584 missense probably damaging 0.99
R6111:D630003M21Rik UTSW 2 158213448 missense probably damaging 1.00
R6225:D630003M21Rik UTSW 2 158217401 missense probably benign 0.23
R6307:D630003M21Rik UTSW 2 158215951 missense probably benign 0.34
R6350:D630003M21Rik UTSW 2 158220495 missense probably damaging 1.00
R6548:D630003M21Rik UTSW 2 158205699 critical splice donor site probably null
R6583:D630003M21Rik UTSW 2 158220516 missense probably damaging 0.98
R6821:D630003M21Rik UTSW 2 158204774 missense probably damaging 1.00
R6963:D630003M21Rik UTSW 2 158200308 missense probably benign 0.44
R7021:D630003M21Rik UTSW 2 158216750 missense possibly damaging 0.59
R7210:D630003M21Rik UTSW 2 158216012 critical splice acceptor site probably null
R7345:D630003M21Rik UTSW 2 158217209 missense probably damaging 1.00
R7355:D630003M21Rik UTSW 2 158200224 missense probably damaging 1.00
R7514:D630003M21Rik UTSW 2 158217353 missense probably damaging 1.00
R7587:D630003M21Rik UTSW 2 158196388 missense probably benign 0.00
R7587:D630003M21Rik UTSW 2 158201056 missense probably damaging 1.00
R7713:D630003M21Rik UTSW 2 158216778 nonsense probably null
R7792:D630003M21Rik UTSW 2 158210162 missense possibly damaging 0.94
R7819:D630003M21Rik UTSW 2 158216798 missense probably damaging 0.97
R8115:D630003M21Rik UTSW 2 158216590 missense probably benign 0.23
R8482:D630003M21Rik UTSW 2 158216932 missense probably benign 0.01
R8829:D630003M21Rik UTSW 2 158216936 missense probably damaging 0.98
V7580:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
V7581:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
V7583:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AGACAGTTGTGTAAGGGACGTC -3'
(R):5'- TGGCTATTTGAGGTCCCATG -3'

Sequencing Primer
(F):5'- GGACGTCCCTCAAAGTCATTG -3'
(R):5'- TTCCTGCATGAGGGCTG -3'
Posted On2019-12-20