Incidental Mutation 'R0121:Grhl3'
List |< first << previous [record 26 of 56] next >> last >|
ID60570
Institutional Source Beutler Lab
Gene Symbol Grhl3
Ensembl Gene ENSMUSG00000037188
Gene Namegrainyhead like transcription factor 3
SynonymsSom, ct, Get1
MMRRC Submission 038406-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R0121 (G1)
Quality Score159
Status Validated
Chromosome4
Chromosomal Location135541888-135573630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135552549 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 398 (I398T)
Ref Sequence ENSEMBL: ENSMUSP00000101481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105855]
Predicted Effect probably damaging
Transcript: ENSMUST00000105855
AA Change: I398T

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101481
Gene: ENSMUSG00000037188
AA Change: I398T

DomainStartEndE-ValueType
Pfam:CP2 215 421 2.5e-81 PFAM
Meta Mutation Damage Score 0.3398 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the grainyhead family of transcription factors. The encoded protein may function as a transcription factor during development, and has been shown to stimulate migration of endothelial cells. Multiple transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for the variably penetrant curly-tail mutation (ct) show symptoms of cranial or spinal neural tube defects such as curly tails and/or spina bifida; homozygotes with more severe phenotypes display exencephaly and die in utero. Homozygous knockout mice show severe neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,259,786 probably null Het
Adgra3 T C 5: 50,025,786 probably benign Het
Anxa7 A T 14: 20,460,159 L386M probably damaging Het
Ap2b1 A G 11: 83,321,967 M58V possibly damaging Het
Arfip2 A G 7: 105,636,371 L224P probably damaging Het
Arhgap20 A G 9: 51,838,951 N373S possibly damaging Het
Asph T C 4: 9,635,918 D73G probably damaging Het
Atp1a2 T A 1: 172,289,342 E236V probably damaging Het
Atp2a1 A G 7: 126,457,944 S170P probably damaging Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
B4galnt3 C T 6: 120,215,038 R578H probably benign Het
Ccdc178 C A 18: 21,845,024 probably null Het
Ccnh T A 13: 85,206,193 M252K probably damaging Het
Clec4b2 A G 6: 123,204,172 D172G probably benign Het
Col1a1 A G 11: 94,938,069 E79G unknown Het
Csf3r A G 4: 126,029,849 N51D probably benign Het
Cul7 C T 17: 46,663,373 L1489F probably damaging Het
Cyp2b13 G A 7: 26,086,585 C309Y probably benign Het
Dync2h1 A T 9: 7,001,327 probably benign Het
Edn1 A G 13: 42,305,265 T135A probably benign Het
Ephb2 A G 4: 136,771,057 I237T probably damaging Het
Fam111a T A 19: 12,584,080 F12L probably benign Het
Foxi2 C A 7: 135,411,911 A290E probably benign Het
Gabra6 A G 11: 42,314,971 S353P probably benign Het
Gm4847 T C 1: 166,642,288 D72G probably damaging Het
Gtdc1 T C 2: 44,565,538 probably benign Het
Kel A C 6: 41,702,064 probably benign Het
L3mbtl3 C T 10: 26,313,870 D499N unknown Het
Lama1 T A 17: 67,798,513 probably benign Het
Mamdc2 T A 19: 23,310,859 E605V probably benign Het
Nolc1 G A 19: 46,081,378 probably benign Het
Nudt12 A T 17: 59,007,639 S317T possibly damaging Het
Olfr1085 A G 2: 86,657,819 V213A probably benign Het
Olfr1153 A G 2: 87,897,090 K297R possibly damaging Het
Olfr1277 A T 2: 111,270,314 C18S probably benign Het
Olfr937 T A 9: 39,059,760 K302M probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pbld1 C T 10: 63,071,503 probably benign Het
Prl8a9 T G 13: 27,560,606 N84T probably benign Het
Psph T A 5: 129,791,570 probably benign Het
Sbf2 A G 7: 110,489,219 probably null Het
Senp6 A G 9: 80,116,670 D405G probably benign Het
Serpinb1a T A 13: 32,848,771 probably benign Het
Slc2a9 T C 5: 38,398,743 I287V probably benign Het
Sptbn2 T C 19: 4,745,293 F1593S probably damaging Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tdrd3 A T 14: 87,539,479 Q727L probably damaging Het
Tecpr1 C T 5: 144,210,199 E450K probably benign Het
Tenm3 G A 8: 48,342,659 T532I probably damaging Het
Tg A T 15: 66,740,781 Q396L probably benign Het
Tmtc3 A G 10: 100,458,908 probably benign Het
Twnk T C 19: 45,009,265 probably benign Het
Ubac1 A G 2: 26,008,859 probably null Het
Ubn2 T C 6: 38,452,858 probably benign Het
Zfp944 T A 17: 22,339,268 T333S possibly damaging Het
Other mutations in Grhl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02638:Grhl3 APN 4 135556865 missense probably benign 0.00
IGL02868:Grhl3 APN 4 135554604 missense probably damaging 1.00
Bite-size UTSW 4 135557433 missense possibly damaging 0.46
hammerkop UTSW 4 135546246 missense probably damaging 1.00
hoopoe UTSW 4 135559146 missense probably benign 0.00
R0180:Grhl3 UTSW 4 135554530 missense probably benign 0.00
R0627:Grhl3 UTSW 4 135552681 missense probably benign 0.18
R0727:Grhl3 UTSW 4 135546254 missense possibly damaging 0.90
R1248:Grhl3 UTSW 4 135561306 missense probably benign 0.01
R1664:Grhl3 UTSW 4 135552550 missense probably benign 0.11
R2910:Grhl3 UTSW 4 135559146 missense probably benign 0.00
R2911:Grhl3 UTSW 4 135559146 missense probably benign 0.00
R3773:Grhl3 UTSW 4 135555847 nonsense probably null
R4033:Grhl3 UTSW 4 135573424 start codon destroyed probably benign
R4521:Grhl3 UTSW 4 135546250 missense probably damaging 1.00
R4576:Grhl3 UTSW 4 135561251 missense probably damaging 1.00
R4650:Grhl3 UTSW 4 135549236 splice site probably null
R4697:Grhl3 UTSW 4 135548466 missense probably damaging 1.00
R4919:Grhl3 UTSW 4 135559104 nonsense probably null
R4920:Grhl3 UTSW 4 135559104 nonsense probably null
R4961:Grhl3 UTSW 4 135552607 missense probably damaging 1.00
R5100:Grhl3 UTSW 4 135542675 missense probably benign
R5180:Grhl3 UTSW 4 135559104 nonsense probably null
R5181:Grhl3 UTSW 4 135559104 nonsense probably null
R5325:Grhl3 UTSW 4 135559104 nonsense probably null
R6429:Grhl3 UTSW 4 135557196 missense probably damaging 0.99
R6459:Grhl3 UTSW 4 135557433 missense possibly damaging 0.46
R7047:Grhl3 UTSW 4 135549240 splice site probably null
R7073:Grhl3 UTSW 4 135573412 missense probably benign 0.00
R7345:Grhl3 UTSW 4 135546246 missense probably damaging 1.00
R7797:Grhl3 UTSW 4 135559105 missense possibly damaging 0.93
R7829:Grhl3 UTSW 4 135561221 missense probably damaging 0.98
R8023:Grhl3 UTSW 4 135550329 missense probably benign
Z1177:Grhl3 UTSW 4 135552686 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCCATAGAGCCCGATTTACAGACC -3'
(R):5'- TCCTTAGCGTGAAGTGTCACCTCC -3'

Sequencing Primer
(F):5'- AATTGACAGACAGGGACTGG -3'
(R):5'- CTGAACTCTGAGATCTGAGTAGACC -3'
Posted On2013-07-24