Incidental Mutation 'R7832:Scn4a'
ID605723
Institutional Source Beutler Lab
Gene Symbol Scn4a
Ensembl Gene ENSMUSG00000001027
Gene Namesodium channel, voltage-gated, type IV, alpha
SynonymsSkM1, mH2, Nav1.4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7832 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location106318592-106353288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106322015 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1388 (I1388T)
Ref Sequence ENSEMBL: ENSMUSP00000021056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021056]
Predicted Effect probably benign
Transcript: ENSMUST00000021056
AA Change: I1388T

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000021056
Gene: ENSMUSG00000001027
AA Change: I1388T

DomainStartEndE-ValueType
Pfam:Ion_trans 130 452 1.1e-80 PFAM
low complexity region 473 491 N/A INTRINSIC
Pfam:Ion_trans 571 805 4.2e-56 PFAM
Pfam:Na_trans_assoc 810 1020 3.2e-59 PFAM
Pfam:Ion_trans 1024 1299 1.4e-64 PFAM
Pfam:Ion_trans 1346 1603 6.1e-55 PFAM
Pfam:PKD_channel 1441 1598 1.4e-6 PFAM
IQ 1720 1742 2.5e-2 SMART
low complexity region 1815 1827 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (78/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. It is expressed in skeletal muscle, and mutations in this gene have been linked to several myotonia and periodic paralysis disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele develop myotonia, increased myofiber damage, K+-sensitive paralysis and susceptibility to delayed weakness during recovery from fatigue. Homozygotes show perinatal lethality, low survival rate, unusual hind-limb clasping and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd11 G A 5: 135,009,800 C30Y probably benign Het
Akr1c20 C T 13: 4,512,672 V95M probably damaging Het
Ano7 A G 1: 93,394,473 D401G probably benign Het
Arhgef10l G A 4: 140,578,305 T176I possibly damaging Het
Armc2 A C 10: 41,966,796 V337G probably damaging Het
Atp6v0d2 T A 4: 19,922,400 Y33F probably benign Het
Banp A G 8: 122,020,552 S447G probably benign Het
Car8 T A 4: 8,238,860 Y32F possibly damaging Het
Ccdc188 C T 16: 18,218,675 P124S probably damaging Het
Cdc23 A T 18: 34,647,019 D85E probably benign Het
Cnot6l T C 5: 96,094,225 E213G possibly damaging Het
Cntnap4 A G 8: 112,757,481 T389A probably benign Het
Cramp1l A T 17: 24,983,222 C429S probably damaging Het
Crygn T C 5: 24,756,074 H78R probably benign Het
D630003M21Rik T A 2: 158,217,668 D104V probably damaging Het
Dcaf10 T G 4: 45,348,196 H217Q probably damaging Het
Dmrtb1 C T 4: 107,683,982 V61M probably benign Het
Dnaic1 A G 4: 41,605,823 E271G probably benign Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Emsy G A 7: 98,639,853 T79M probably damaging Het
Ergic1 A G 17: 26,634,475 D145G probably damaging Het
Fah A G 7: 84,595,478 V229A probably damaging Het
Fam196b A G 11: 34,403,034 T359A probably benign Het
Fam76a G A 4: 132,902,031 T270I probably damaging Het
Fat4 A T 3: 39,001,204 M4191L probably benign Het
Fbxl22 G T 9: 66,511,717 R213S probably benign Het
Fktn T C 4: 53,734,859 F127L probably benign Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Gabbr2 A T 4: 46,734,096 S541T probably benign Het
Gm7489 A G 15: 53,886,006 H158R unknown Het
Greb1l G C 18: 10,542,056 E1268Q probably benign Het
H2-D1 A G 17: 35,263,872 D126G probably damaging Het
Ikzf3 T A 11: 98,518,699 T13S probably benign Het
Il23r T C 6: 67,423,862 T495A probably benign Het
Irf5 A G 6: 29,535,462 T230A probably benign Het
Itga2b A T 11: 102,457,282 I831N probably damaging Het
Itgb4 A G 11: 116,000,261 D1168G probably damaging Het
Kcnma1 G T 14: 23,390,923 P605Q probably benign Het
Larp7 A T 3: 127,544,267 M381K possibly damaging Het
Lfng G A 5: 140,612,833 G269D probably benign Het
Liph T C 16: 21,962,236 I335V probably benign Het
Map2k2 A T 10: 81,118,206 I169F possibly damaging Het
Mmrn1 T A 6: 60,987,060 probably null Het
Nod2 A G 8: 88,660,797 probably null Het
Olfr1413 T C 1: 92,573,497 F109L probably benign Het
Olfr1453 T A 19: 13,027,996 Y111F probably benign Het
Olfr610 A C 7: 103,506,379 L189R probably damaging Het
Pcdh20 G T 14: 88,469,707 F52L probably null Het
Pkhd1 A T 1: 20,502,999 N1894K probably damaging Het
Pla2r1 T A 2: 60,504,192 D412V possibly damaging Het
Pole T G 5: 110,317,797 M1197R probably benign Het
Pom121l2 C T 13: 21,983,878 T773I possibly damaging Het
Ppp2r5d A T 17: 46,684,546 M497K probably benign Het
Rbm45 G T 2: 76,376,453 V270F possibly damaging Het
Ros1 A T 10: 52,144,861 F673I probably damaging Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Sema3c G A 5: 17,694,847 V446I probably damaging Het
Six4 T C 12: 73,112,634 Y176C probably damaging Het
Slc35a5 T A 16: 45,144,207 K221M possibly damaging Het
Slc6a19 A G 13: 73,693,063 I76T probably damaging Het
Slfn4 A G 11: 83,186,593 D69G probably damaging Het
Smc6 T C 12: 11,317,843 F1085L probably benign Het
Spatc1l A G 10: 76,562,390 S9G probably benign Het
Stx8 T A 11: 68,109,280 I182N probably damaging Het
Sult2a8 A T 7: 14,413,671 C232S probably benign Het
Susd4 G A 1: 182,858,505 A207T probably benign Het
Svep1 G A 4: 58,054,539 P3350S probably benign Het
Tbx20 A T 9: 24,773,812 S12T probably damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Umodl1 A T 17: 30,973,692 probably null Het
Vmn1r201 T C 13: 22,475,368 F251L possibly damaging Het
Vmn1r230 A G 17: 20,846,671 T41A probably benign Het
Vmn2r20 A G 6: 123,385,923 L634P probably damaging Het
Vmn2r81 A T 10: 79,293,830 R852W probably damaging Het
Wdr41 A T 13: 95,015,193 N287I probably benign Het
Zfp202 A G 9: 40,210,462 D285G possibly damaging Het
Other mutations in Scn4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Scn4a APN 11 106319919 missense probably benign
IGL00846:Scn4a APN 11 106328118 missense probably benign 0.03
IGL01063:Scn4a APN 11 106330364 missense possibly damaging 0.91
IGL01450:Scn4a APN 11 106324661 missense probably damaging 0.99
IGL01922:Scn4a APN 11 106339152 critical splice donor site probably null
IGL02589:Scn4a APN 11 106328132 missense probably benign 0.08
IGL03171:Scn4a APN 11 106345592 missense probably benign 0.01
IGL03338:Scn4a APN 11 106320845 missense probably damaging 1.00
BB004:Scn4a UTSW 11 106342383 missense probably damaging 1.00
BB014:Scn4a UTSW 11 106342383 missense probably damaging 1.00
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0050:Scn4a UTSW 11 106320856 missense probably damaging 1.00
R0113:Scn4a UTSW 11 106345436 missense probably benign 0.00
R0193:Scn4a UTSW 11 106320538 nonsense probably null
R0410:Scn4a UTSW 11 106323949 missense probably damaging 1.00
R0512:Scn4a UTSW 11 106345677 missense probably damaging 1.00
R0532:Scn4a UTSW 11 106330400 missense probably benign 0.45
R1112:Scn4a UTSW 11 106320466 missense probably damaging 1.00
R1279:Scn4a UTSW 11 106335682 missense probably damaging 1.00
R1564:Scn4a UTSW 11 106345541 missense probably benign
R1712:Scn4a UTSW 11 106339354 missense probably damaging 1.00
R1712:Scn4a UTSW 11 106345547 missense probably benign 0.20
R1721:Scn4a UTSW 11 106320820 missense probably benign 0.31
R1900:Scn4a UTSW 11 106327533 missense probably damaging 1.00
R2057:Scn4a UTSW 11 106335724 missense probably damaging 0.97
R2209:Scn4a UTSW 11 106339225 missense probably damaging 1.00
R3416:Scn4a UTSW 11 106330413 missense probably benign 0.00
R3788:Scn4a UTSW 11 106344274 missense probably damaging 0.96
R3853:Scn4a UTSW 11 106320106 missense possibly damaging 0.94
R3861:Scn4a UTSW 11 106326124 splice site probably benign
R3912:Scn4a UTSW 11 106320716 missense probably damaging 1.00
R3983:Scn4a UTSW 11 106347818 missense probably damaging 1.00
R4036:Scn4a UTSW 11 106322057 missense possibly damaging 0.75
R4358:Scn4a UTSW 11 106348857 splice site probably null
R4556:Scn4a UTSW 11 106320446 missense probably benign 0.32
R4677:Scn4a UTSW 11 106323962 missense probably damaging 1.00
R4863:Scn4a UTSW 11 106320002 missense probably damaging 1.00
R4924:Scn4a UTSW 11 106320088 missense possibly damaging 0.83
R5081:Scn4a UTSW 11 106348727 missense probably damaging 0.99
R5298:Scn4a UTSW 11 106339386 missense probably damaging 1.00
R5407:Scn4a UTSW 11 106320889 missense probably damaging 1.00
R5634:Scn4a UTSW 11 106330004 missense probably benign
R6381:Scn4a UTSW 11 106320311 missense probably damaging 1.00
R6468:Scn4a UTSW 11 106345676 missense probably damaging 1.00
R6489:Scn4a UTSW 11 106349180 missense probably benign 0.26
R6549:Scn4a UTSW 11 106343965 missense probably damaging 1.00
R6606:Scn4a UTSW 11 106328073 missense probably benign 0.39
R7037:Scn4a UTSW 11 106320900 missense probably damaging 0.98
R7064:Scn4a UTSW 11 106322157 missense possibly damaging 0.93
R7182:Scn4a UTSW 11 106330308 missense probably benign 0.21
R7194:Scn4a UTSW 11 106324236 missense probably benign 0.32
R7531:Scn4a UTSW 11 106348697 splice site probably null
R7552:Scn4a UTSW 11 106349169 missense probably benign 0.22
R7570:Scn4a UTSW 11 106320473 missense possibly damaging 0.54
R7635:Scn4a UTSW 11 106324632 missense probably damaging 1.00
R7823:Scn4a UTSW 11 106342508 missense probably damaging 1.00
R7927:Scn4a UTSW 11 106342383 missense probably damaging 1.00
R8122:Scn4a UTSW 11 106330331 missense probably benign 0.02
R8131:Scn4a UTSW 11 106341541 missense probably benign
X0012:Scn4a UTSW 11 106330061 missense probably damaging 1.00
X0065:Scn4a UTSW 11 106322178 missense probably damaging 0.98
Z1176:Scn4a UTSW 11 106321908 missense probably null 0.29
Z1176:Scn4a UTSW 11 106341529 missense probably benign 0.26
Z1176:Scn4a UTSW 11 106341530 missense probably damaging 0.97
Z1177:Scn4a UTSW 11 106330208 missense not run
Z1177:Scn4a UTSW 11 106341542 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCCTATGAACAATGCCTTTG -3'
(R):5'- CCGTGTCACTGCAGAACAAG -3'

Sequencing Primer
(F):5'- TTGTGTATTAAAGGTGAAAGAATGGC -3'
(R):5'- GTGTCACTGCAGAACAAGATCCAAG -3'
Posted On2019-12-20