Incidental Mutation 'R7832:Pom121l2'
ID605728
Institutional Source Beutler Lab
Gene Symbol Pom121l2
Ensembl Gene ENSMUSG00000016982
Gene NamePOM121 membrane glycoprotein-like 2 (rat)
SynonymsLOC195236
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7832 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location21981194-21988734 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21983878 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 773 (T773I)
Ref Sequence ENSEMBL: ENSMUSP00000017126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017126] [ENSMUST00000117882]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017126
AA Change: T773I

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000017126
Gene: ENSMUSG00000016982
AA Change: T773I

DomainStartEndE-ValueType
low complexity region 42 60 N/A INTRINSIC
Pfam:POM121 162 301 3.5e-24 PFAM
low complexity region 367 379 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
low complexity region 517 526 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117882
SMART Domains Protein: ENSMUSP00000113688
Gene: ENSMUSG00000016982

DomainStartEndE-ValueType
low complexity region 42 60 N/A INTRINSIC
Pfam:POM121 162 301 2e-24 PFAM
low complexity region 367 379 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (78/80)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd11 G A 5: 135,009,800 C30Y probably benign Het
Akr1c20 C T 13: 4,512,672 V95M probably damaging Het
Ano7 A G 1: 93,394,473 D401G probably benign Het
Arhgef10l G A 4: 140,578,305 T176I possibly damaging Het
Armc2 A C 10: 41,966,796 V337G probably damaging Het
Atp6v0d2 T A 4: 19,922,400 Y33F probably benign Het
Banp A G 8: 122,020,552 S447G probably benign Het
Car8 T A 4: 8,238,860 Y32F possibly damaging Het
Ccdc188 C T 16: 18,218,675 P124S probably damaging Het
Cdc23 A T 18: 34,647,019 D85E probably benign Het
Cnot6l T C 5: 96,094,225 E213G possibly damaging Het
Cntnap4 A G 8: 112,757,481 T389A probably benign Het
Cramp1l A T 17: 24,983,222 C429S probably damaging Het
Crygn T C 5: 24,756,074 H78R probably benign Het
D630003M21Rik T A 2: 158,217,668 D104V probably damaging Het
Dcaf10 T G 4: 45,348,196 H217Q probably damaging Het
Dmrtb1 C T 4: 107,683,982 V61M probably benign Het
Dnaic1 A G 4: 41,605,823 E271G probably benign Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Emsy G A 7: 98,639,853 T79M probably damaging Het
Ergic1 A G 17: 26,634,475 D145G probably damaging Het
Fah A G 7: 84,595,478 V229A probably damaging Het
Fam196b A G 11: 34,403,034 T359A probably benign Het
Fam76a G A 4: 132,902,031 T270I probably damaging Het
Fat4 A T 3: 39,001,204 M4191L probably benign Het
Fbxl22 G T 9: 66,511,717 R213S probably benign Het
Fktn T C 4: 53,734,859 F127L probably benign Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Gabbr2 A T 4: 46,734,096 S541T probably benign Het
Gm7489 A G 15: 53,886,006 H158R unknown Het
Greb1l G C 18: 10,542,056 E1268Q probably benign Het
H2-D1 A G 17: 35,263,872 D126G probably damaging Het
Ikzf3 T A 11: 98,518,699 T13S probably benign Het
Il23r T C 6: 67,423,862 T495A probably benign Het
Irf5 A G 6: 29,535,462 T230A probably benign Het
Itga2b A T 11: 102,457,282 I831N probably damaging Het
Itgb4 A G 11: 116,000,261 D1168G probably damaging Het
Kcnma1 G T 14: 23,390,923 P605Q probably benign Het
Larp7 A T 3: 127,544,267 M381K possibly damaging Het
Lfng G A 5: 140,612,833 G269D probably benign Het
Liph T C 16: 21,962,236 I335V probably benign Het
Map2k2 A T 10: 81,118,206 I169F possibly damaging Het
Mmrn1 T A 6: 60,987,060 probably null Het
Nod2 A G 8: 88,660,797 probably null Het
Olfr1413 T C 1: 92,573,497 F109L probably benign Het
Olfr1453 T A 19: 13,027,996 Y111F probably benign Het
Olfr610 A C 7: 103,506,379 L189R probably damaging Het
Pcdh20 G T 14: 88,469,707 F52L probably null Het
Pkhd1 A T 1: 20,502,999 N1894K probably damaging Het
Pla2r1 T A 2: 60,504,192 D412V possibly damaging Het
Pole T G 5: 110,317,797 M1197R probably benign Het
Ppp2r5d A T 17: 46,684,546 M497K probably benign Het
Rbm45 G T 2: 76,376,453 V270F possibly damaging Het
Ros1 A T 10: 52,144,861 F673I probably damaging Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Scn4a A G 11: 106,322,015 I1388T probably benign Het
Sema3c G A 5: 17,694,847 V446I probably damaging Het
Six4 T C 12: 73,112,634 Y176C probably damaging Het
Slc35a5 T A 16: 45,144,207 K221M possibly damaging Het
Slc6a19 A G 13: 73,693,063 I76T probably damaging Het
Slfn4 A G 11: 83,186,593 D69G probably damaging Het
Smc6 T C 12: 11,317,843 F1085L probably benign Het
Spatc1l A G 10: 76,562,390 S9G probably benign Het
Stx8 T A 11: 68,109,280 I182N probably damaging Het
Sult2a8 A T 7: 14,413,671 C232S probably benign Het
Susd4 G A 1: 182,858,505 A207T probably benign Het
Svep1 G A 4: 58,054,539 P3350S probably benign Het
Tbx20 A T 9: 24,773,812 S12T probably damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Umodl1 A T 17: 30,973,692 probably null Het
Vmn1r201 T C 13: 22,475,368 F251L possibly damaging Het
Vmn1r230 A G 17: 20,846,671 T41A probably benign Het
Vmn2r20 A G 6: 123,385,923 L634P probably damaging Het
Vmn2r81 A T 10: 79,293,830 R852W probably damaging Het
Wdr41 A T 13: 95,015,193 N287I probably benign Het
Zfp202 A G 9: 40,210,462 D285G possibly damaging Het
Other mutations in Pom121l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Pom121l2 APN 13 21982275 missense possibly damaging 0.70
IGL02223:Pom121l2 APN 13 21982095 missense probably benign 0.01
R0401:Pom121l2 UTSW 13 21982225 missense probably benign 0.01
R0402:Pom121l2 UTSW 13 21988479 splice site probably benign
R0437:Pom121l2 UTSW 13 21983205 missense possibly damaging 0.72
R0575:Pom121l2 UTSW 13 21984168 missense probably damaging 0.99
R0605:Pom121l2 UTSW 13 21982036 missense probably damaging 1.00
R0892:Pom121l2 UTSW 13 21982474 missense possibly damaging 0.49
R0992:Pom121l2 UTSW 13 21982759 missense probably benign 0.01
R1259:Pom121l2 UTSW 13 21982127 nonsense probably null
R1564:Pom121l2 UTSW 13 21983353 missense possibly damaging 0.86
R1603:Pom121l2 UTSW 13 21983344 missense probably damaging 1.00
R1836:Pom121l2 UTSW 13 21983784 missense probably benign 0.03
R1970:Pom121l2 UTSW 13 21983472 missense probably damaging 0.98
R2018:Pom121l2 UTSW 13 21982734 missense possibly damaging 0.54
R2180:Pom121l2 UTSW 13 21981975 missense probably benign 0.08
R2277:Pom121l2 UTSW 13 21984247 missense probably benign
R2365:Pom121l2 UTSW 13 21983784 missense probably benign 0.20
R3951:Pom121l2 UTSW 13 21982128 missense probably damaging 1.00
R4371:Pom121l2 UTSW 13 21982239 missense probably benign 0.01
R4574:Pom121l2 UTSW 13 21984402 missense probably benign 0.02
R4593:Pom121l2 UTSW 13 21984453 missense probably damaging 1.00
R4983:Pom121l2 UTSW 13 21983814 missense probably benign 0.02
R5320:Pom121l2 UTSW 13 21981845 nonsense probably null
R5661:Pom121l2 UTSW 13 21984255 missense possibly damaging 0.90
R5662:Pom121l2 UTSW 13 21982188 missense probably benign 0.01
R5908:Pom121l2 UTSW 13 21981814 missense probably damaging 0.99
R5980:Pom121l2 UTSW 13 21983376 missense probably damaging 0.96
R6145:Pom121l2 UTSW 13 21982302 nonsense probably null
R6160:Pom121l2 UTSW 13 21983668 missense possibly damaging 0.52
R6327:Pom121l2 UTSW 13 21982332 missense probably damaging 1.00
R6504:Pom121l2 UTSW 13 21983461 missense possibly damaging 0.55
R6745:Pom121l2 UTSW 13 21983698 missense probably benign 0.00
R6750:Pom121l2 UTSW 13 21981937 missense probably damaging 1.00
R6752:Pom121l2 UTSW 13 21981769 missense probably damaging 0.99
R6796:Pom121l2 UTSW 13 21983524 missense probably benign 0.09
R6984:Pom121l2 UTSW 13 21982021 missense probably benign 0.33
R7284:Pom121l2 UTSW 13 21982605 missense probably damaging 1.00
R7287:Pom121l2 UTSW 13 21984332 missense probably benign 0.16
R7568:Pom121l2 UTSW 13 21982626 missense probably benign 0.03
R7624:Pom121l2 UTSW 13 21983529 missense probably damaging 0.97
R7915:Pom121l2 UTSW 13 21983878 missense possibly damaging 0.49
R8103:Pom121l2 UTSW 13 21982374 missense probably benign 0.00
Z1177:Pom121l2 UTSW 13 21988486 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CATCATCTTTGGGGTCAAGCC -3'
(R):5'- AGCAAAAGGTCTTGGGGCTG -3'

Sequencing Primer
(F):5'- GTCAAGCCCAAAGCCACTTTTG -3'
(R):5'- GCTGTGCTGCCAAAAACTG -3'
Posted On2019-12-20