Incidental Mutation 'R7832:Umodl1'
ID 605743
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Name uromodulin-like 1
Synonyms D17Ertd488e
MMRRC Submission 045886-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7832 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 31173614-31229684 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 31192666 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000067443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000066981] [ENSMUST00000114555] [ENSMUST00000114555]
AlphaFold Q5DID3
Predicted Effect probably null
Transcript: ENSMUST00000066554
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066554
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066981
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066981
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114555
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114555
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Meta Mutation Damage Score 0.9487 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (78/80)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd11 G A 5: 135,038,654 (GRCm39) C30Y probably benign Het
Akr1c20 C T 13: 4,562,671 (GRCm39) V95M probably damaging Het
Ano7 A G 1: 93,322,195 (GRCm39) D401G probably benign Het
Arhgef10l G A 4: 140,305,616 (GRCm39) T176I possibly damaging Het
Armc2 A C 10: 41,842,792 (GRCm39) V337G probably damaging Het
Atp6v0d2 T A 4: 19,922,400 (GRCm39) Y33F probably benign Het
Banp A G 8: 122,747,291 (GRCm39) S447G probably benign Het
Car8 T A 4: 8,238,860 (GRCm39) Y32F possibly damaging Het
Ccdc188 C T 16: 18,036,539 (GRCm39) P124S probably damaging Het
Cdc23 A T 18: 34,780,072 (GRCm39) D85E probably benign Het
Cnot6l T C 5: 96,242,084 (GRCm39) E213G possibly damaging Het
Cntnap4 A G 8: 113,484,113 (GRCm39) T389A probably benign Het
Cramp1 A T 17: 25,202,196 (GRCm39) C429S probably damaging Het
Crygn T C 5: 24,961,072 (GRCm39) H78R probably benign Het
D630003M21Rik T A 2: 158,059,588 (GRCm39) D104V probably damaging Het
Dcaf10 T G 4: 45,348,196 (GRCm39) H217Q probably damaging Het
Dmrtb1 C T 4: 107,541,179 (GRCm39) V61M probably benign Het
Dnai1 A G 4: 41,605,823 (GRCm39) E271G probably benign Het
Efr3a G A 15: 65,701,679 (GRCm39) V198I probably benign Het
Emsy G A 7: 98,289,060 (GRCm39) T79M probably damaging Het
Ergic1 A G 17: 26,853,449 (GRCm39) D145G probably damaging Het
Fah A G 7: 84,244,686 (GRCm39) V229A probably damaging Het
Fam76a G A 4: 132,629,342 (GRCm39) T270I probably damaging Het
Fat4 A T 3: 39,055,353 (GRCm39) M4191L probably benign Het
Fbxl22 G T 9: 66,418,999 (GRCm39) R213S probably benign Het
Fktn T C 4: 53,734,859 (GRCm39) F127L probably benign Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,436,769 (GRCm39) probably benign Het
Gabbr2 A T 4: 46,734,096 (GRCm39) S541T probably benign Het
Gm7489 A G 15: 53,749,402 (GRCm39) H158R unknown Het
Greb1l G C 18: 10,542,056 (GRCm39) E1268Q probably benign Het
H2-D1 A G 17: 35,482,848 (GRCm39) D126G probably damaging Het
Ikzf3 T A 11: 98,409,525 (GRCm39) T13S probably benign Het
Il23r T C 6: 67,400,846 (GRCm39) T495A probably benign Het
Insyn2b A G 11: 34,353,034 (GRCm39) T359A probably benign Het
Irf5 A G 6: 29,535,461 (GRCm39) T230A probably benign Het
Itga2b A T 11: 102,348,108 (GRCm39) I831N probably damaging Het
Itgb4 A G 11: 115,891,087 (GRCm39) D1168G probably damaging Het
Kcnma1 G T 14: 23,440,991 (GRCm39) P605Q probably benign Het
Larp7 A T 3: 127,337,916 (GRCm39) M381K possibly damaging Het
Lfng G A 5: 140,598,588 (GRCm39) G269D probably benign Het
Liph T C 16: 21,780,986 (GRCm39) I335V probably benign Het
Map2k2 A T 10: 80,954,040 (GRCm39) I169F possibly damaging Het
Mmrn1 T A 6: 60,964,044 (GRCm39) probably null Het
Nod2 A G 8: 89,387,425 (GRCm39) probably null Het
Or51ag1 A C 7: 103,155,586 (GRCm39) L189R probably damaging Het
Or5b101 T A 19: 13,005,360 (GRCm39) Y111F probably benign Het
Or9s23 T C 1: 92,501,219 (GRCm39) F109L probably benign Het
Pcdh20 G T 14: 88,707,143 (GRCm39) F52L probably null Het
Pkhd1 A T 1: 20,573,223 (GRCm39) N1894K probably damaging Het
Pla2r1 T A 2: 60,334,536 (GRCm39) D412V possibly damaging Het
Pole T G 5: 110,465,663 (GRCm39) M1197R probably benign Het
Pom121l2 C T 13: 22,168,048 (GRCm39) T773I possibly damaging Het
Ppp2r5d A T 17: 46,995,472 (GRCm39) M497K probably benign Het
Rbm45 G T 2: 76,206,797 (GRCm39) V270F possibly damaging Het
Ros1 A T 10: 52,020,957 (GRCm39) F673I probably damaging Het
Rtn4 T A 11: 29,691,048 (GRCm39) L1113* probably null Het
Scn4a A G 11: 106,212,841 (GRCm39) I1388T probably benign Het
Sema3c G A 5: 17,899,845 (GRCm39) V446I probably damaging Het
Six4 T C 12: 73,159,408 (GRCm39) Y176C probably damaging Het
Slc35a5 T A 16: 44,964,570 (GRCm39) K221M possibly damaging Het
Slc6a19 A G 13: 73,841,182 (GRCm39) I76T probably damaging Het
Slfn4 A G 11: 83,077,419 (GRCm39) D69G probably damaging Het
Smc6 T C 12: 11,367,844 (GRCm39) F1085L probably benign Het
Spatc1l A G 10: 76,398,224 (GRCm39) S9G probably benign Het
Stx8 T A 11: 68,000,106 (GRCm39) I182N probably damaging Het
Sult2a8 A T 7: 14,147,596 (GRCm39) C232S probably benign Het
Susd4 G A 1: 182,686,070 (GRCm39) A207T probably benign Het
Svep1 G A 4: 58,054,539 (GRCm39) P3350S probably benign Het
Tbx20 A T 9: 24,685,108 (GRCm39) S12T probably damaging Het
Tfrc A G 16: 32,437,985 (GRCm39) K346R probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Vmn1r201 T C 13: 22,659,538 (GRCm39) F251L possibly damaging Het
Vmn1r230 A G 17: 21,066,933 (GRCm39) T41A probably benign Het
Vmn2r20 A G 6: 123,362,882 (GRCm39) L634P probably damaging Het
Vmn2r81 A T 10: 79,129,664 (GRCm39) R852W probably damaging Het
Wdr41 A T 13: 95,151,701 (GRCm39) N287I probably benign Het
Zfp202 A G 9: 40,121,758 (GRCm39) D285G possibly damaging Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31,227,724 (GRCm39) utr 3 prime probably benign
IGL01344:Umodl1 APN 17 31,215,238 (GRCm39) missense probably damaging 0.99
IGL01529:Umodl1 APN 17 31,215,233 (GRCm39) missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 31,217,800 (GRCm39) missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 31,215,229 (GRCm39) missense probably benign 0.00
IGL01877:Umodl1 APN 17 31,201,294 (GRCm39) missense probably benign 0.00
IGL01977:Umodl1 APN 17 31,192,742 (GRCm39) missense probably damaging 0.99
IGL02063:Umodl1 APN 17 31,206,888 (GRCm39) missense probably benign 0.07
IGL02160:Umodl1 APN 17 31,205,091 (GRCm39) missense probably damaging 0.97
IGL02252:Umodl1 APN 17 31,213,789 (GRCm39) critical splice donor site probably null
IGL02427:Umodl1 APN 17 31,187,415 (GRCm39) splice site probably benign
IGL02496:Umodl1 APN 17 31,217,628 (GRCm39) missense probably damaging 0.99
IGL02633:Umodl1 APN 17 31,208,462 (GRCm39) missense probably damaging 1.00
IGL03271:Umodl1 APN 17 31,205,473 (GRCm39) nonsense probably null
IGL03392:Umodl1 APN 17 31,215,329 (GRCm39) missense probably damaging 0.98
Disquieting UTSW 17 31,178,129 (GRCm39) missense probably damaging 1.00
floored UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7231_umodl1_507 UTSW 17 31,205,090 (GRCm39) missense probably damaging 1.00
surprising UTSW 17 31,205,439 (GRCm39) missense possibly damaging 0.77
unsettling UTSW 17 31,205,528 (GRCm39) nonsense probably null
G1citation:Umodl1 UTSW 17 31,205,528 (GRCm39) nonsense probably null
PIT4468001:Umodl1 UTSW 17 31,178,252 (GRCm39) missense probably damaging 1.00
R0048:Umodl1 UTSW 17 31,187,451 (GRCm39) missense probably damaging 1.00
R0048:Umodl1 UTSW 17 31,187,451 (GRCm39) missense probably damaging 1.00
R0653:Umodl1 UTSW 17 31,203,002 (GRCm39) missense probably benign 0.00
R0831:Umodl1 UTSW 17 31,215,325 (GRCm39) missense probably damaging 1.00
R1078:Umodl1 UTSW 17 31,178,347 (GRCm39) missense probably benign 0.00
R1166:Umodl1 UTSW 17 31,221,772 (GRCm39) splice site probably benign
R1231:Umodl1 UTSW 17 31,178,252 (GRCm39) missense probably damaging 1.00
R1459:Umodl1 UTSW 17 31,205,478 (GRCm39) missense probably benign 0.05
R1459:Umodl1 UTSW 17 31,201,232 (GRCm39) splice site probably benign
R1510:Umodl1 UTSW 17 31,178,203 (GRCm39) missense probably damaging 1.00
R1654:Umodl1 UTSW 17 31,206,942 (GRCm39) missense probably benign
R1757:Umodl1 UTSW 17 31,227,674 (GRCm39) missense probably damaging 0.99
R1781:Umodl1 UTSW 17 31,187,524 (GRCm39) missense probably damaging 1.00
R1873:Umodl1 UTSW 17 31,201,238 (GRCm39) missense probably damaging 0.99
R1911:Umodl1 UTSW 17 31,211,128 (GRCm39) missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 31,203,017 (GRCm39) missense probably damaging 1.00
R1918:Umodl1 UTSW 17 31,203,017 (GRCm39) missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31,227,740 (GRCm39) critical splice donor site probably null
R2058:Umodl1 UTSW 17 31,227,740 (GRCm39) critical splice donor site probably null
R2089:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2091:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2091:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2431:Umodl1 UTSW 17 31,211,062 (GRCm39) missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 31,211,147 (GRCm39) missense probably damaging 1.00
R3032:Umodl1 UTSW 17 31,208,502 (GRCm39) missense probably benign 0.01
R3956:Umodl1 UTSW 17 31,221,837 (GRCm39) missense probably benign 0.10
R3975:Umodl1 UTSW 17 31,203,763 (GRCm39) nonsense probably null
R4207:Umodl1 UTSW 17 31,178,341 (GRCm39) missense probably damaging 1.00
R4287:Umodl1 UTSW 17 31,207,039 (GRCm39) missense probably benign 0.11
R4452:Umodl1 UTSW 17 31,213,789 (GRCm39) critical splice donor site probably null
R4684:Umodl1 UTSW 17 31,217,088 (GRCm39) missense probably benign 0.00
R4769:Umodl1 UTSW 17 31,202,976 (GRCm39) missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31,227,639 (GRCm39) missense probably benign 0.06
R4888:Umodl1 UTSW 17 31,218,175 (GRCm39) missense probably damaging 1.00
R4978:Umodl1 UTSW 17 31,205,055 (GRCm39) missense probably benign
R4993:Umodl1 UTSW 17 31,205,459 (GRCm39) missense probably benign 0.00
R5241:Umodl1 UTSW 17 31,203,066 (GRCm39) missense probably benign 0.18
R5254:Umodl1 UTSW 17 31,199,333 (GRCm39) missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 31,205,439 (GRCm39) missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 31,201,263 (GRCm39) missense probably benign 0.04
R5754:Umodl1 UTSW 17 31,213,761 (GRCm39) missense probably damaging 0.96
R6189:Umodl1 UTSW 17 31,215,256 (GRCm39) missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31,221,866 (GRCm39) critical splice donor site probably null
R6289:Umodl1 UTSW 17 31,201,325 (GRCm39) missense probably benign 0.16
R6432:Umodl1 UTSW 17 31,205,121 (GRCm39) missense probably benign 0.38
R6478:Umodl1 UTSW 17 31,178,129 (GRCm39) missense probably damaging 1.00
R6702:Umodl1 UTSW 17 31,205,273 (GRCm39) splice site probably null
R6822:Umodl1 UTSW 17 31,205,528 (GRCm39) nonsense probably null
R6999:Umodl1 UTSW 17 31,218,097 (GRCm39) missense probably damaging 1.00
R7067:Umodl1 UTSW 17 31,201,246 (GRCm39) missense probably damaging 1.00
R7123:Umodl1 UTSW 17 31,201,318 (GRCm39) missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 31,201,236 (GRCm39) critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 31,205,090 (GRCm39) missense probably damaging 1.00
R7234:Umodl1 UTSW 17 31,205,595 (GRCm39) missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31,227,639 (GRCm39) missense probably benign 0.06
R7392:Umodl1 UTSW 17 31,201,306 (GRCm39) missense probably damaging 0.99
R7401:Umodl1 UTSW 17 31,217,122 (GRCm39) missense probably damaging 1.00
R7461:Umodl1 UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7594:Umodl1 UTSW 17 31,173,779 (GRCm39) missense probably benign 0.02
R7613:Umodl1 UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7763:Umodl1 UTSW 17 31,205,430 (GRCm39) missense probably benign 0.24
R7797:Umodl1 UTSW 17 31,178,125 (GRCm39) missense probably benign 0.02
R7954:Umodl1 UTSW 17 31,205,361 (GRCm39) missense probably benign 0.00
R8088:Umodl1 UTSW 17 31,192,770 (GRCm39) missense probably benign 0.29
R8111:Umodl1 UTSW 17 31,190,792 (GRCm39) missense probably damaging 0.99
R8314:Umodl1 UTSW 17 31,203,806 (GRCm39) missense probably damaging 0.99
R8826:Umodl1 UTSW 17 31,202,958 (GRCm39) missense possibly damaging 0.65
R9067:Umodl1 UTSW 17 31,192,677 (GRCm39) missense probably damaging 1.00
R9091:Umodl1 UTSW 17 31,185,678 (GRCm39) missense probably damaging 1.00
R9099:Umodl1 UTSW 17 31,178,147 (GRCm39) missense probably benign 0.01
R9270:Umodl1 UTSW 17 31,185,678 (GRCm39) missense probably damaging 1.00
R9341:Umodl1 UTSW 17 31,217,701 (GRCm39) missense possibly damaging 0.95
R9343:Umodl1 UTSW 17 31,217,701 (GRCm39) missense possibly damaging 0.95
R9400:Umodl1 UTSW 17 31,215,367 (GRCm39) missense probably damaging 0.99
R9569:Umodl1 UTSW 17 31,217,143 (GRCm39) missense probably damaging 1.00
R9615:Umodl1 UTSW 17 31,217,152 (GRCm39) missense possibly damaging 0.94
R9787:Umodl1 UTSW 17 31,178,324 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCAGGAAACTTCTGGTTC -3'
(R):5'- TGGCCGTAGTACTTGAGGTC -3'

Sequencing Primer
(F):5'- CAGGAAACTTCTGGTTCCTTTG -3'
(R):5'- CCGTAGTACTTGAGGTCCATAAGC -3'
Posted On 2019-12-20