Incidental Mutation 'R7832:Umodl1'
ID605743
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Nameuromodulin-like 1
SynonymsD17Ertd488e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7832 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location30954679-31010708 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 30973692 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000067443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000066981] [ENSMUST00000114555] [ENSMUST00000114555]
Predicted Effect probably null
Transcript: ENSMUST00000066554
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066554
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066981
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066981
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114555
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114555
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd11 G A 5: 135,009,800 C30Y probably benign Het
Akr1c20 C T 13: 4,512,672 V95M probably damaging Het
Ano7 A G 1: 93,394,473 D401G probably benign Het
Arhgef10l G A 4: 140,578,305 T176I possibly damaging Het
Armc2 A C 10: 41,966,796 V337G probably damaging Het
Atp6v0d2 T A 4: 19,922,400 Y33F probably benign Het
Banp A G 8: 122,020,552 S447G probably benign Het
Car8 T A 4: 8,238,860 Y32F possibly damaging Het
Ccdc188 C T 16: 18,218,675 P124S probably damaging Het
Cdc23 A T 18: 34,647,019 D85E probably benign Het
Cnot6l T C 5: 96,094,225 E213G possibly damaging Het
Cntnap4 A G 8: 112,757,481 T389A probably benign Het
Cramp1l A T 17: 24,983,222 C429S probably damaging Het
Crygn T C 5: 24,756,074 H78R probably benign Het
D630003M21Rik T A 2: 158,217,668 D104V probably damaging Het
Dcaf10 T G 4: 45,348,196 H217Q probably damaging Het
Dmrtb1 C T 4: 107,683,982 V61M probably benign Het
Dnaic1 A G 4: 41,605,823 E271G probably benign Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Emsy G A 7: 98,639,853 T79M probably damaging Het
Ergic1 A G 17: 26,634,475 D145G probably damaging Het
Fah A G 7: 84,595,478 V229A probably damaging Het
Fam196b A G 11: 34,403,034 T359A probably benign Het
Fam76a G A 4: 132,902,031 T270I probably damaging Het
Fat4 A T 3: 39,001,204 M4191L probably benign Het
Fbxl22 G T 9: 66,511,717 R213S probably benign Het
Fktn T C 4: 53,734,859 F127L probably benign Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Gabbr2 A T 4: 46,734,096 S541T probably benign Het
Gm7489 A G 15: 53,886,006 H158R unknown Het
Greb1l G C 18: 10,542,056 E1268Q probably benign Het
H2-D1 A G 17: 35,263,872 D126G probably damaging Het
Ikzf3 T A 11: 98,518,699 T13S probably benign Het
Il23r T C 6: 67,423,862 T495A probably benign Het
Irf5 A G 6: 29,535,462 T230A probably benign Het
Itga2b A T 11: 102,457,282 I831N probably damaging Het
Itgb4 A G 11: 116,000,261 D1168G probably damaging Het
Kcnma1 G T 14: 23,390,923 P605Q probably benign Het
Larp7 A T 3: 127,544,267 M381K possibly damaging Het
Lfng G A 5: 140,612,833 G269D probably benign Het
Liph T C 16: 21,962,236 I335V probably benign Het
Map2k2 A T 10: 81,118,206 I169F possibly damaging Het
Olfr1413 T C 1: 92,573,497 F109L probably benign Het
Olfr1453 T A 19: 13,027,996 Y111F probably benign Het
Olfr610 A C 7: 103,506,379 L189R probably damaging Het
Pcdh20 G T 14: 88,469,707 F52L probably null Het
Pkhd1 A T 1: 20,502,999 N1894K probably damaging Het
Pla2r1 T A 2: 60,504,192 D412V possibly damaging Het
Pole T G 5: 110,317,797 M1197R probably benign Het
Pom121l2 C T 13: 21,983,878 T773I possibly damaging Het
Ppp2r5d A T 17: 46,684,546 M497K probably benign Het
Rasgrf1 A T 9: 89,910,167 D57V probably damaging Het
Rbm45 G T 2: 76,376,453 V270F possibly damaging Het
Ros1 A T 10: 52,144,861 F673I probably damaging Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Scn4a A G 11: 106,322,015 I1388T probably benign Het
Sema3c G A 5: 17,694,847 V446I probably damaging Het
Six4 T C 12: 73,112,634 Y176C probably damaging Het
Slc35a5 T A 16: 45,144,207 K221M possibly damaging Het
Slc6a19 A G 13: 73,693,063 I76T probably damaging Het
Slfn4 A G 11: 83,186,593 D69G probably damaging Het
Smc6 T C 12: 11,317,843 F1085L probably benign Het
Spatc1l A G 10: 76,562,390 S9G probably benign Het
Stx8 T A 11: 68,109,280 I182N probably damaging Het
Sult2a8 A T 7: 14,413,671 C232S probably benign Het
Susd4 G A 1: 182,858,505 A207T probably benign Het
Svep1 G A 4: 58,054,539 P3350S probably benign Het
Tbx20 A T 9: 24,773,812 S12T probably damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Ttll3 GGCAAAG GGCAAAGCAAAG 6: 113,399,155 probably null Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vmn1r201 T C 13: 22,475,368 F251L possibly damaging Het
Vmn1r230 A G 17: 20,846,671 T41A probably benign Het
Vmn2r20 A G 6: 123,385,923 L634P probably damaging Het
Vmn2r81 A T 10: 79,293,830 R852W probably damaging Het
Wdr41 A T 13: 95,015,193 N287I probably benign Het
Zfp202 A G 9: 40,210,462 D285G possibly damaging Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31008750 utr 3 prime probably benign
IGL01344:Umodl1 APN 17 30996264 missense probably damaging 0.99
IGL01529:Umodl1 APN 17 30996259 missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 30998826 missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 30996255 missense probably benign 0.00
IGL01877:Umodl1 APN 17 30982320 missense probably benign 0.00
IGL01977:Umodl1 APN 17 30973768 missense probably damaging 0.99
IGL02063:Umodl1 APN 17 30987914 missense probably benign 0.07
IGL02160:Umodl1 APN 17 30986117 missense probably damaging 0.97
IGL02252:Umodl1 APN 17 30994815 critical splice donor site probably null
IGL02427:Umodl1 APN 17 30968441 splice site probably benign
IGL02496:Umodl1 APN 17 30998654 missense probably damaging 0.99
IGL02633:Umodl1 APN 17 30989488 missense probably damaging 1.00
IGL03271:Umodl1 APN 17 30986499 nonsense probably null
IGL03392:Umodl1 APN 17 30996355 missense probably damaging 0.98
floored UTSW 17 30988057 nonsense probably null
surprising UTSW 17 30986465 missense possibly damaging 0.77
unsettling UTSW 17 30986554 nonsense probably null
PIT4468001:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0653:Umodl1 UTSW 17 30984028 missense probably benign 0.00
R0831:Umodl1 UTSW 17 30996351 missense probably damaging 1.00
R1078:Umodl1 UTSW 17 30959373 missense probably benign 0.00
R1166:Umodl1 UTSW 17 31002798 splice site probably benign
R1231:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R1459:Umodl1 UTSW 17 30982258 splice site probably benign
R1459:Umodl1 UTSW 17 30986504 missense probably benign 0.05
R1510:Umodl1 UTSW 17 30959229 missense probably damaging 1.00
R1654:Umodl1 UTSW 17 30987968 missense probably benign
R1757:Umodl1 UTSW 17 31008700 missense probably damaging 0.99
R1781:Umodl1 UTSW 17 30968550 missense probably damaging 1.00
R1873:Umodl1 UTSW 17 30982264 missense probably damaging 0.99
R1911:Umodl1 UTSW 17 30992154 missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R1918:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2058:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2089:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2431:Umodl1 UTSW 17 30992088 missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 30992173 missense probably damaging 1.00
R3032:Umodl1 UTSW 17 30989528 missense probably benign 0.01
R3956:Umodl1 UTSW 17 31002863 missense probably benign 0.10
R3975:Umodl1 UTSW 17 30984789 nonsense probably null
R4207:Umodl1 UTSW 17 30959367 missense probably damaging 1.00
R4287:Umodl1 UTSW 17 30988065 missense probably benign 0.11
R4452:Umodl1 UTSW 17 30994815 critical splice donor site probably null
R4684:Umodl1 UTSW 17 30998114 missense probably benign 0.00
R4769:Umodl1 UTSW 17 30984002 missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R4888:Umodl1 UTSW 17 30999201 missense probably damaging 1.00
R4978:Umodl1 UTSW 17 30986081 missense probably benign
R4993:Umodl1 UTSW 17 30986485 missense probably benign 0.00
R5241:Umodl1 UTSW 17 30984092 missense probably benign 0.18
R5254:Umodl1 UTSW 17 30980359 missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 30986465 missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 30982289 missense probably benign 0.04
R5754:Umodl1 UTSW 17 30994787 missense probably damaging 0.96
R6189:Umodl1 UTSW 17 30996282 missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31002892 critical splice donor site probably null
R6289:Umodl1 UTSW 17 30982351 missense probably benign 0.16
R6432:Umodl1 UTSW 17 30986147 missense probably benign 0.38
R6478:Umodl1 UTSW 17 30959155 missense probably damaging 1.00
R6702:Umodl1 UTSW 17 30986299 splice site probably null
R6822:Umodl1 UTSW 17 30986554 nonsense probably null
R6999:Umodl1 UTSW 17 30999123 missense probably damaging 1.00
R7067:Umodl1 UTSW 17 30982272 missense probably damaging 1.00
R7123:Umodl1 UTSW 17 30982344 missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 30982262 critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 30986116 missense probably damaging 1.00
R7234:Umodl1 UTSW 17 30986621 missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R7392:Umodl1 UTSW 17 30982332 missense probably damaging 0.99
R7401:Umodl1 UTSW 17 30998148 missense probably damaging 1.00
R7461:Umodl1 UTSW 17 30988057 nonsense probably null
R7594:Umodl1 UTSW 17 30954805 missense probably benign 0.02
R7613:Umodl1 UTSW 17 30988057 nonsense probably null
R7763:Umodl1 UTSW 17 30986456 missense probably benign 0.24
R7797:Umodl1 UTSW 17 30959151 missense probably benign 0.02
R7915:Umodl1 UTSW 17 30973692 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGCTCAGGAAACTTCTGGTTC -3'
(R):5'- TGGCCGTAGTACTTGAGGTC -3'

Sequencing Primer
(F):5'- CAGGAAACTTCTGGTTCCTTTG -3'
(R):5'- CCGTAGTACTTGAGGTCCATAAGC -3'
Posted On2019-12-20