Incidental Mutation 'R7832:Greb1l'
ID605746
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Namegrowth regulation by estrogen in breast cancer-like
SynonymsAK220484, mKIAA4095
MMRRC Submission
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7832 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location10325177-10562934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 10542056 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 1268 (E1268Q)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]
Predicted Effect probably benign
Transcript: ENSMUST00000048977
AA Change: E1268Q

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: E1268Q

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172532
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (78/80)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd11 G A 5: 135,009,800 C30Y probably benign Het
Akr1c20 C T 13: 4,512,672 V95M probably damaging Het
Ano7 A G 1: 93,394,473 D401G probably benign Het
Arhgef10l G A 4: 140,578,305 T176I possibly damaging Het
Armc2 A C 10: 41,966,796 V337G probably damaging Het
Atp6v0d2 T A 4: 19,922,400 Y33F probably benign Het
Banp A G 8: 122,020,552 S447G probably benign Het
Car8 T A 4: 8,238,860 Y32F possibly damaging Het
Ccdc188 C T 16: 18,218,675 P124S probably damaging Het
Cdc23 A T 18: 34,647,019 D85E probably benign Het
Cnot6l T C 5: 96,094,225 E213G possibly damaging Het
Cntnap4 A G 8: 112,757,481 T389A probably benign Het
Cramp1l A T 17: 24,983,222 C429S probably damaging Het
Crygn T C 5: 24,756,074 H78R probably benign Het
D630003M21Rik T A 2: 158,217,668 D104V probably damaging Het
Dcaf10 T G 4: 45,348,196 H217Q probably damaging Het
Dmrtb1 C T 4: 107,683,982 V61M probably benign Het
Dnaic1 A G 4: 41,605,823 E271G probably benign Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Emsy G A 7: 98,639,853 T79M probably damaging Het
Ergic1 A G 17: 26,634,475 D145G probably damaging Het
Fah A G 7: 84,595,478 V229A probably damaging Het
Fam196b A G 11: 34,403,034 T359A probably benign Het
Fam76a G A 4: 132,902,031 T270I probably damaging Het
Fat4 A T 3: 39,001,204 M4191L probably benign Het
Fbxl22 G T 9: 66,511,717 R213S probably benign Het
Fktn T C 4: 53,734,859 F127L probably benign Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Gabbr2 A T 4: 46,734,096 S541T probably benign Het
Gm7489 A G 15: 53,886,006 H158R unknown Het
H2-D1 A G 17: 35,263,872 D126G probably damaging Het
Ikzf3 T A 11: 98,518,699 T13S probably benign Het
Il23r T C 6: 67,423,862 T495A probably benign Het
Irf5 A G 6: 29,535,462 T230A probably benign Het
Itga2b A T 11: 102,457,282 I831N probably damaging Het
Itgb4 A G 11: 116,000,261 D1168G probably damaging Het
Kcnma1 G T 14: 23,390,923 P605Q probably benign Het
Larp7 A T 3: 127,544,267 M381K possibly damaging Het
Lfng G A 5: 140,612,833 G269D probably benign Het
Liph T C 16: 21,962,236 I335V probably benign Het
Map2k2 A T 10: 81,118,206 I169F possibly damaging Het
Mmrn1 T A 6: 60,987,060 probably null Het
Nod2 A G 8: 88,660,797 probably null Het
Olfr1413 T C 1: 92,573,497 F109L probably benign Het
Olfr1453 T A 19: 13,027,996 Y111F probably benign Het
Olfr610 A C 7: 103,506,379 L189R probably damaging Het
Pcdh20 G T 14: 88,469,707 F52L probably null Het
Pkhd1 A T 1: 20,502,999 N1894K probably damaging Het
Pla2r1 T A 2: 60,504,192 D412V possibly damaging Het
Pole T G 5: 110,317,797 M1197R probably benign Het
Pom121l2 C T 13: 21,983,878 T773I possibly damaging Het
Ppp2r5d A T 17: 46,684,546 M497K probably benign Het
Rbm45 G T 2: 76,376,453 V270F possibly damaging Het
Ros1 A T 10: 52,144,861 F673I probably damaging Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Scn4a A G 11: 106,322,015 I1388T probably benign Het
Sema3c G A 5: 17,694,847 V446I probably damaging Het
Six4 T C 12: 73,112,634 Y176C probably damaging Het
Slc35a5 T A 16: 45,144,207 K221M possibly damaging Het
Slc6a19 A G 13: 73,693,063 I76T probably damaging Het
Slfn4 A G 11: 83,186,593 D69G probably damaging Het
Smc6 T C 12: 11,317,843 F1085L probably benign Het
Spatc1l A G 10: 76,562,390 S9G probably benign Het
Stx8 T A 11: 68,109,280 I182N probably damaging Het
Sult2a8 A T 7: 14,413,671 C232S probably benign Het
Susd4 G A 1: 182,858,505 A207T probably benign Het
Svep1 G A 4: 58,054,539 P3350S probably benign Het
Tbx20 A T 9: 24,773,812 S12T probably damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Umodl1 A T 17: 30,973,692 probably null Het
Vmn1r201 T C 13: 22,475,368 F251L possibly damaging Het
Vmn1r230 A G 17: 20,846,671 T41A probably benign Het
Vmn2r20 A G 6: 123,385,923 L634P probably damaging Het
Vmn2r81 A T 10: 79,293,830 R852W probably damaging Het
Wdr41 A T 13: 95,015,193 N287I probably benign Het
Zfp202 A G 9: 40,210,462 D285G possibly damaging Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7934:Greb1l UTSW 18 10474371 nonsense probably null
R8137:Greb1l UTSW 18 10474357 missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10533060 missense probably benign 0.13
R8208:Greb1l UTSW 18 10510703 missense probably damaging 1.00
R8227:Greb1l UTSW 18 10515371 missense probably damaging 1.00
R8312:Greb1l UTSW 18 10511587 intron probably benign
R8331:Greb1l UTSW 18 10458706 missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10529687 missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10529613 missense probably benign 0.00
R8695:Greb1l UTSW 18 10544450 missense probably benign 0.01
R8795:Greb1l UTSW 18 10553739 missense probably damaging 0.98
R8836:Greb1l UTSW 18 10509257 missense probably benign 0.30
R8862:Greb1l UTSW 18 10555042 missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10529684 missense probably benign 0.18
R8874:Greb1l UTSW 18 10544896 missense probably benign 0.01
R8886:Greb1l UTSW 18 10553843 missense probably benign 0.21
R8921:Greb1l UTSW 18 10541825 missense probably benign 0.01
Z1176:Greb1l UTSW 18 10515305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAAGCAGGAGTGTGACTC -3'
(R):5'- TTACAGCCAAGACAGGGTCC -3'

Sequencing Primer
(F):5'- AGTGTGACTCCTTGGACCC -3'
(R):5'- GGTCCACCCTGCACTATCTG -3'
Posted On2019-12-20