Incidental Mutation 'R7833:Tns1'
ID 605750
Institutional Source Beutler Lab
Gene Symbol Tns1
Ensembl Gene ENSMUSG00000055322
Gene Name tensin 1
Synonyms E030018G17Rik, 1110018I21Rik, E030037J05Rik, 1200014E20Rik, Tns
MMRRC Submission 045887-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.565) question?
Stock # R7833 (G1)
Quality Score 177.009
Status Validated
Chromosome 1
Chromosomal Location 73949390-74163608 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to A at 74130490 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169786] [ENSMUST00000187584] [ENSMUST00000188208] [ENSMUST00000191104] [ENSMUST00000212888]
AlphaFold E9Q0S6
Predicted Effect probably benign
Transcript: ENSMUST00000169786
SMART Domains Protein: ENSMUSP00000127715
Gene: ENSMUSG00000055322

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
C1 62 108 1.77e-2 SMART
low complexity region 154 167 N/A INTRINSIC
SCOP:d1d5ra2 176 348 3e-32 SMART
PTEN_C2 350 477 1.12e-51 SMART
low complexity region 822 833 N/A INTRINSIC
low complexity region 905 922 N/A INTRINSIC
low complexity region 1227 1239 N/A INTRINSIC
low complexity region 1284 1300 N/A INTRINSIC
low complexity region 1459 1470 N/A INTRINSIC
low complexity region 1518 1530 N/A INTRINSIC
SH2 1614 1716 6.85e-17 SMART
PTB 1747 1888 1.69e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187584
SMART Domains Protein: ENSMUSP00000140254
Gene: ENSMUSG00000055322

DomainStartEndE-ValueType
C1 21 67 8.6e-5 SMART
low complexity region 113 124 N/A INTRINSIC
PTPc_DSPc 197 319 9.9e-6 SMART
PTEN_C2 306 433 5.6e-56 SMART
low complexity region 778 789 N/A INTRINSIC
low complexity region 861 878 N/A INTRINSIC
low complexity region 1162 1174 N/A INTRINSIC
low complexity region 1219 1235 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1453 1465 N/A INTRINSIC
SH2 1549 1651 4.3e-19 SMART
PTB 1682 1823 9e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188208
SMART Domains Protein: ENSMUSP00000140837
Gene: ENSMUSG00000055322

DomainStartEndE-ValueType
C1 16 62 8.6e-5 SMART
low complexity region 108 119 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191104
SMART Domains Protein: ENSMUSP00000140317
Gene: ENSMUSG00000055322

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
C1 62 108 8.6e-5 SMART
low complexity region 154 167 N/A INTRINSIC
PTPc_DSPc 241 363 9.9e-6 SMART
PTEN_C2 350 477 5.6e-56 SMART
low complexity region 822 833 N/A INTRINSIC
low complexity region 905 922 N/A INTRINSIC
low complexity region 1206 1218 N/A INTRINSIC
low complexity region 1263 1279 N/A INTRINSIC
low complexity region 1438 1449 N/A INTRINSIC
low complexity region 1497 1509 N/A INTRINSIC
SH2 1593 1695 4.3e-19 SMART
PTB 1726 1867 9e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191204
Predicted Effect probably benign
Transcript: ENSMUST00000212888
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecules involved in signal transduction. This protein is a substrate of calpain II. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility, and develop kidney cysts and progressive kidney degeneration that may lead to death from renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,902,059 (GRCm39) S578T possibly damaging Het
Acot5 A G 12: 84,122,601 (GRCm39) Q395R probably damaging Het
Adamts15 T A 9: 30,833,401 (GRCm39) T45S probably benign Het
Agbl2 A G 2: 90,645,777 (GRCm39) K837E probably benign Het
Atf2 T C 2: 73,684,229 (GRCm39) T19A possibly damaging Het
Atp6v0a2 T C 5: 124,782,969 (GRCm39) V238A probably damaging Het
Atp9a A T 2: 168,516,777 (GRCm39) V430E probably benign Het
Cachd1 G A 4: 100,832,012 (GRCm39) V725I probably benign Het
Ccnb1 G A 13: 100,917,859 (GRCm39) T247M probably damaging Het
Cd40 A T 2: 164,908,431 (GRCm39) D169V probably benign Het
Cdc25c G A 18: 34,880,296 (GRCm39) T146I probably benign Het
Cdhr18 A T 14: 13,896,968 (GRCm38) probably null Het
Ceacam3 C A 7: 16,893,778 (GRCm39) Q430K Het
Cerkl G A 2: 79,171,724 (GRCm39) T378I probably benign Het
Cpn2 G T 16: 30,079,163 (GRCm39) N179K probably damaging Het
Duox1 A G 2: 122,154,869 (GRCm39) D418G probably damaging Het
Eif1ad13 G A 12: 87,762,322 (GRCm39) R14K unknown Het
Eps8l1 C A 7: 4,471,866 (GRCm39) P11T possibly damaging Het
Erc1 C T 6: 119,801,447 (GRCm39) W190* probably null Het
Exosc7 A T 9: 122,959,984 (GRCm39) E195V probably benign Het
F2rl2 A G 13: 95,837,426 (GRCm39) N157S probably damaging Het
Fgd2 T C 17: 29,586,369 (GRCm39) L270P possibly damaging Het
Fitm2 A T 2: 163,312,019 (GRCm39) W65R probably damaging Het
Gabbr1 T G 17: 37,367,861 (GRCm39) I437S possibly damaging Het
Galntl6 A T 8: 58,310,571 (GRCm39) S377T probably benign Het
Gml2 T A 15: 74,693,217 (GRCm39) C73* probably null Het
Htr6 G T 4: 138,789,142 (GRCm39) F304L probably damaging Het
Hydin G A 8: 111,316,092 (GRCm39) G4328D probably damaging Het
Kcnj14 T C 7: 45,467,317 (GRCm39) D343G probably damaging Het
Klhdc1 T A 12: 69,329,942 (GRCm39) I357N probably benign Het
Lcor A G 19: 41,573,024 (GRCm39) D593G probably benign Het
Man2a1 A G 17: 64,973,746 (GRCm39) T341A probably damaging Het
Mrm1 A C 11: 84,709,469 (GRCm39) V196G probably damaging Het
Mybbp1a A G 11: 72,333,727 (GRCm39) probably null Het
Myo19 G A 11: 84,800,093 (GRCm39) C826Y probably benign Het
Nbea A G 3: 55,910,218 (GRCm39) W1326R probably damaging Het
Notch1 A G 2: 26,349,545 (GRCm39) *2532Q probably null Het
Npas2 A G 1: 39,365,228 (GRCm39) Y287C probably damaging Het
Or3a1b G A 11: 74,012,663 (GRCm39) D183N probably damaging Het
Or9g20 T A 2: 85,630,293 (GRCm39) D107V probably benign Het
Pate7 T A 9: 35,688,406 (GRCm39) S60C probably damaging Het
Pcdhga7 C A 18: 37,849,077 (GRCm39) D361E possibly damaging Het
Pde10a T A 17: 9,180,752 (GRCm39) Y447N possibly damaging Het
Piwil2 T A 14: 70,632,890 (GRCm39) I561F probably benign Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Ppp4r4 A G 12: 103,564,407 (GRCm39) T591A probably benign Het
Prxl2c T C 13: 64,460,092 (GRCm39) S84G probably benign Het
Ptprb A G 10: 116,151,156 (GRCm39) T273A probably benign Het
Ptpro T A 6: 137,393,861 (GRCm39) L843* probably null Het
Qrfpr T C 3: 36,243,751 (GRCm39) I117V probably benign Het
Qrich2 T C 11: 116,346,591 (GRCm39) D1411G probably benign Het
Rad51ap2 T C 12: 11,506,656 (GRCm39) S193P probably benign Het
Raver1 T C 9: 20,992,610 (GRCm39) E273G probably benign Het
Rubcn C A 16: 32,688,644 (GRCm39) probably benign Het
S1pr4 C T 10: 81,334,326 (GRCm39) V383I possibly damaging Het
Scn7a T C 2: 66,506,494 (GRCm39) D1465G probably damaging Het
Smarca4 T A 9: 21,558,655 (GRCm39) D607E possibly damaging Het
Srbd1 T A 17: 86,292,882 (GRCm39) I896L possibly damaging Het
Sulf2 G T 2: 165,921,456 (GRCm39) N722K possibly damaging Het
Surf1 A G 2: 26,806,280 (GRCm39) Y22H probably benign Het
Syngr2 A G 11: 117,703,982 (GRCm39) T150A probably benign Het
Szt2 G T 4: 118,223,416 (GRCm39) H3056N unknown Het
Tmf1 A T 6: 97,138,372 (GRCm39) S849T probably benign Het
Trio G T 15: 27,774,172 (GRCm39) P1764Q probably damaging Het
Trpc3 A T 3: 36,694,821 (GRCm39) V711D probably damaging Het
Ttll3 G T 6: 113,386,298 (GRCm39) K710N probably damaging Het
Unc13c A G 9: 73,388,391 (GRCm39) S2132P possibly damaging Het
Utp20 G A 10: 88,636,998 (GRCm39) P738S possibly damaging Het
Vmn2r76 C T 7: 85,877,892 (GRCm39) V502I probably benign Het
Vsig1 C T X: 139,833,875 (GRCm39) H232Y probably benign Het
Wdr64 T G 1: 175,591,511 (GRCm39) F390V probably damaging Het
Ybx3 T G 6: 131,344,826 (GRCm39) T341P possibly damaging Het
Zdhhc11 C A 13: 74,121,866 (GRCm39) Q126K possibly damaging Het
Zfp777 G A 6: 48,002,072 (GRCm39) P673S probably damaging Het
Other mutations in Tns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Tns1 APN 1 73,964,128 (GRCm39) missense probably damaging 0.99
IGL01288:Tns1 APN 1 73,992,969 (GRCm39) missense probably damaging 1.00
IGL01536:Tns1 APN 1 73,958,807 (GRCm39) splice site probably benign
IGL01568:Tns1 APN 1 73,992,668 (GRCm39) missense probably damaging 1.00
IGL01683:Tns1 APN 1 73,992,428 (GRCm39) missense probably damaging 0.98
IGL02267:Tns1 APN 1 74,031,290 (GRCm39) missense possibly damaging 0.95
IGL02597:Tns1 APN 1 74,025,032 (GRCm39) critical splice donor site probably null
IGL02819:Tns1 APN 1 73,976,407 (GRCm39) missense probably damaging 0.99
IGL03370:Tns1 APN 1 74,025,053 (GRCm39) missense probably damaging 1.00
R0087:Tns1 UTSW 1 73,956,076 (GRCm39) missense possibly damaging 0.95
R0207:Tns1 UTSW 1 73,976,477 (GRCm39) critical splice acceptor site probably null
R0411:Tns1 UTSW 1 73,964,920 (GRCm39) missense probably damaging 0.96
R0543:Tns1 UTSW 1 73,991,856 (GRCm39) missense probably benign 0.01
R0552:Tns1 UTSW 1 73,959,722 (GRCm39) missense probably damaging 1.00
R0720:Tns1 UTSW 1 73,964,740 (GRCm39) missense probably benign 0.03
R0828:Tns1 UTSW 1 73,958,825 (GRCm39) missense probably damaging 1.00
R1034:Tns1 UTSW 1 73,981,128 (GRCm39) missense probably damaging 1.00
R1061:Tns1 UTSW 1 73,956,831 (GRCm39) missense probably damaging 1.00
R1819:Tns1 UTSW 1 73,955,635 (GRCm39) splice site probably benign
R1826:Tns1 UTSW 1 73,992,793 (GRCm39) start codon destroyed probably null 0.91
R2208:Tns1 UTSW 1 74,118,399 (GRCm39) missense probably damaging 1.00
R3723:Tns1 UTSW 1 73,964,099 (GRCm39) missense probably damaging 0.99
R4079:Tns1 UTSW 1 74,034,467 (GRCm39) missense probably damaging 1.00
R4111:Tns1 UTSW 1 73,981,091 (GRCm39) missense probably damaging 1.00
R4155:Tns1 UTSW 1 73,953,790 (GRCm39) missense probably damaging 1.00
R4156:Tns1 UTSW 1 73,953,790 (GRCm39) missense probably damaging 1.00
R4157:Tns1 UTSW 1 73,953,790 (GRCm39) missense probably damaging 1.00
R4274:Tns1 UTSW 1 73,967,257 (GRCm39) missense probably damaging 1.00
R4426:Tns1 UTSW 1 74,024,908 (GRCm39) missense probably damaging 0.97
R4649:Tns1 UTSW 1 73,992,930 (GRCm39) missense probably damaging 1.00
R4742:Tns1 UTSW 1 74,163,449 (GRCm39) critical splice donor site probably null
R4869:Tns1 UTSW 1 73,991,774 (GRCm39) missense probably benign
R4961:Tns1 UTSW 1 73,975,074 (GRCm39) missense probably benign 0.35
R5025:Tns1 UTSW 1 73,964,641 (GRCm39) missense probably damaging 1.00
R5035:Tns1 UTSW 1 73,992,979 (GRCm39) start gained probably benign
R5062:Tns1 UTSW 1 73,992,023 (GRCm39) missense probably damaging 1.00
R5080:Tns1 UTSW 1 73,992,099 (GRCm39) missense probably damaging 1.00
R5213:Tns1 UTSW 1 73,992,771 (GRCm39) missense probably damaging 1.00
R5256:Tns1 UTSW 1 74,034,585 (GRCm39) intron probably benign
R5368:Tns1 UTSW 1 73,980,176 (GRCm39) missense probably benign 0.07
R5391:Tns1 UTSW 1 74,029,568 (GRCm39) splice site probably null
R5587:Tns1 UTSW 1 73,959,755 (GRCm39) missense possibly damaging 0.94
R5735:Tns1 UTSW 1 73,967,138 (GRCm39) missense probably benign 0.00
R5855:Tns1 UTSW 1 73,957,192 (GRCm39) missense possibly damaging 0.83
R5999:Tns1 UTSW 1 73,967,256 (GRCm39) nonsense probably null
R6122:Tns1 UTSW 1 73,991,578 (GRCm39) critical splice donor site probably null
R6148:Tns1 UTSW 1 73,992,612 (GRCm39) missense probably damaging 1.00
R6457:Tns1 UTSW 1 73,957,209 (GRCm39) missense probably damaging 0.99
R6525:Tns1 UTSW 1 73,992,629 (GRCm39) missense probably damaging 1.00
R6712:Tns1 UTSW 1 74,118,460 (GRCm39) nonsense probably null
R6773:Tns1 UTSW 1 73,958,866 (GRCm39) missense probably damaging 1.00
R6825:Tns1 UTSW 1 74,041,482 (GRCm39) nonsense probably null
R7085:Tns1 UTSW 1 73,964,621 (GRCm39) missense probably benign 0.00
R7128:Tns1 UTSW 1 74,034,463 (GRCm39) missense
R7209:Tns1 UTSW 1 73,993,074 (GRCm39) missense possibly damaging 0.68
R7348:Tns1 UTSW 1 73,956,076 (GRCm39) missense possibly damaging 0.95
R7570:Tns1 UTSW 1 73,992,638 (GRCm39) missense probably damaging 1.00
R7670:Tns1 UTSW 1 73,991,636 (GRCm39) missense possibly damaging 0.93
R7769:Tns1 UTSW 1 73,992,530 (GRCm39) missense probably damaging 0.99
R8052:Tns1 UTSW 1 73,992,596 (GRCm39) missense probably damaging 1.00
R8225:Tns1 UTSW 1 74,025,046 (GRCm39) missense probably damaging 1.00
R8244:Tns1 UTSW 1 73,976,410 (GRCm39) missense probably damaging 1.00
R8321:Tns1 UTSW 1 74,024,939 (GRCm39) critical splice acceptor site probably null
R8344:Tns1 UTSW 1 74,024,201 (GRCm39) missense probably damaging 1.00
R8378:Tns1 UTSW 1 73,976,405 (GRCm39) missense probably damaging 1.00
R8434:Tns1 UTSW 1 73,964,765 (GRCm39) missense probably benign 0.00
R8773:Tns1 UTSW 1 73,976,407 (GRCm39) missense probably damaging 0.99
R9211:Tns1 UTSW 1 73,956,948 (GRCm39) missense possibly damaging 0.63
R9251:Tns1 UTSW 1 74,030,855 (GRCm39) missense probably damaging 1.00
R9315:Tns1 UTSW 1 73,980,141 (GRCm39) missense
R9411:Tns1 UTSW 1 73,992,662 (GRCm39) missense probably damaging 1.00
R9592:Tns1 UTSW 1 74,029,553 (GRCm39) missense probably damaging 1.00
R9658:Tns1 UTSW 1 73,981,183 (GRCm39) missense probably benign 0.08
R9658:Tns1 UTSW 1 73,981,182 (GRCm39) missense probably benign 0.14
Z1177:Tns1 UTSW 1 74,041,466 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AACTAAGGCTCTTAGCTGAACAAC -3'
(R):5'- TCCATAGAACCCTGCCTTGG -3'

Sequencing Primer
(F):5'- TGAACAACAGTGGTGCAATCTC -3'
(R):5'- TTGGGCAGACTCCCCTTG -3'
Posted On 2019-12-20