Mutagenetix > Incidental Mutation

Incidental Mutation 'R7833:Tns1'

605750

Institutional Source

Beutler Lab

Gene Symbol

Tns1

Ensembl Gene

ENSMUSG00000055322

Gene Name

tensin 1

Synonyms

1110018I21Rik, 1200014E20Rik, E030018G17Rik, E030037J05Rik, Tns

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.436) question?

Stock #

R7833 (G1)

Quality Score

177.009

Status

Validated

Chromosome

Chromosomal Location

73910231-74124449 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to A at 74091331 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148638 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169786] [ENSMUST00000187584] [ENSMUST00000188208] [ENSMUST00000191104] [ENSMUST00000212888]

AlphaFold

E9Q0S6

Predicted Effect

probably benign
Transcript: ENSMUST00000169786

SMART Domains

Protein: ENSMUSP00000127715
Gene: ENSMUSG00000055322

Domain	Start	End	E-Value	Type
low complexity region	15	33	N/A	INTRINSIC
C1	62	108	1.77e-2	SMART
low complexity region	154	167	N/A	INTRINSIC
SCOP:d1d5ra2	176	348	3e-32	SMART
PTEN_C2	350	477	1.12e-51	SMART
low complexity region	822	833	N/A	INTRINSIC
low complexity region	905	922	N/A	INTRINSIC
low complexity region	1227	1239	N/A	INTRINSIC
low complexity region	1284	1300	N/A	INTRINSIC
low complexity region	1459	1470	N/A	INTRINSIC
low complexity region	1518	1530	N/A	INTRINSIC
SH2	1614	1716	6.85e-17	SMART
PTB	1747	1888	1.69e-29	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000187584

SMART Domains

Protein: ENSMUSP00000140254
Gene: ENSMUSG00000055322

Domain	Start	End	E-Value	Type
C1	21	67	8.6e-5	SMART
low complexity region	113	124	N/A	INTRINSIC
PTPc_DSPc	197	319	9.9e-6	SMART
PTEN_C2	306	433	5.6e-56	SMART
low complexity region	778	789	N/A	INTRINSIC
low complexity region	861	878	N/A	INTRINSIC
low complexity region	1162	1174	N/A	INTRINSIC
low complexity region	1219	1235	N/A	INTRINSIC
low complexity region	1394	1405	N/A	INTRINSIC
low complexity region	1453	1465	N/A	INTRINSIC
SH2	1549	1651	4.3e-19	SMART
PTB	1682	1823	9e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000188208

SMART Domains

Protein: ENSMUSP00000140837
Gene: ENSMUSG00000055322

Domain	Start	End	E-Value	Type
C1	16	62	8.6e-5	SMART
low complexity region	108	119	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000191104

SMART Domains

Protein: ENSMUSP00000140317
Gene: ENSMUSG00000055322

Domain	Start	End	E-Value	Type
low complexity region	15	33	N/A	INTRINSIC
C1	62	108	8.6e-5	SMART
low complexity region	154	167	N/A	INTRINSIC
PTPc_DSPc	241	363	9.9e-6	SMART
PTEN_C2	350	477	5.6e-56	SMART
low complexity region	822	833	N/A	INTRINSIC
low complexity region	905	922	N/A	INTRINSIC
low complexity region	1206	1218	N/A	INTRINSIC
low complexity region	1263	1279	N/A	INTRINSIC
low complexity region	1438	1449	N/A	INTRINSIC
low complexity region	1497	1509	N/A	INTRINSIC
SH2	1593	1695	4.3e-19	SMART
PTB	1726	1867	9e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000191204

Predicted Effect

probably benign
Transcript: ENSMUST00000212888

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecules involved in signal transduction. This protein is a substrate of calpain II. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility, and develop kidney cysts and progressive kidney degeneration that may lead to death from renal failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	T	C	13: 64,312,278	S84G	probably benign	Het
Acin1	A	T	14: 54,664,602	S578T	possibly damaging	Het
Acot5	A	G	12: 84,075,827	Q395R	probably damaging	Het
Adamts15	T	A	9: 30,922,105	T45S	probably benign	Het
Agbl2	A	G	2: 90,815,433	K837E	probably benign	Het
Atf2	T	C	2: 73,853,885	T19A	possibly damaging	Het
Atp6v0a2	T	C	5: 124,645,031	V238A	probably damaging	Het
Atp9a	A	T	2: 168,674,857	V430E	probably benign	Het
Cachd1	G	A	4: 100,974,815	V725I	probably benign	Het
Ccnb1	G	A	13: 100,781,351	T247M	probably damaging	Het
Cd40	A	T	2: 165,066,511	D169V	probably benign	Het
Cdc25c	G	A	18: 34,747,243	T146I	probably benign	Het
Ceacam3	C	A	7: 17,159,853	Q430K		Het
Cerkl	G	A	2: 79,341,380	T378I	probably benign	Het
Cpn2	G	T	16: 30,260,345	N179K	probably damaging	Het
Duox1	A	G	2: 122,324,388	D418G	probably damaging	Het
Eps8l1	C	A	7: 4,468,867	P11T	possibly damaging	Het
Erc1	C	T	6: 119,824,486	W190*	probably null	Het
Exosc7	A	T	9: 123,130,919	E195V	probably benign	Het
F2rl2	A	G	13: 95,700,918	N157S	probably damaging	Het
Fgd2	T	C	17: 29,367,395	L270P	possibly damaging	Het
Fitm2	A	T	2: 163,470,099	W65R	probably damaging	Het
Gabbr1	T	G	17: 37,056,969	I437S	possibly damaging	Het
Galntl6	A	T	8: 57,857,537	S377T	probably benign	Het
Gm17727	T	A	9: 35,777,110	S60C	probably damaging	Het
Gm21936	G	A	12: 87,795,552	R14K	unknown	Het
Gm281	A	T	14: 13,896,968		probably null	Het
Gm340	A	G	19: 41,584,585	D593G	probably benign	Het
Gml2	T	A	15: 74,821,368	C73*	probably null	Het
Htr6	G	T	4: 139,061,831	F304L	probably damaging	Het
Hydin	G	A	8: 110,589,460	G4328D	probably damaging	Het
Kcnj14	T	C	7: 45,817,893	D343G	probably damaging	Het
Klhdc1	T	A	12: 69,283,168	I357N	probably benign	Het
Man2a1	A	G	17: 64,666,751	T341A	probably damaging	Het
Mrm1	A	C	11: 84,818,643	V196G	probably damaging	Het
Mybbp1a	A	G	11: 72,442,901		probably null	Het
Myo19	G	A	11: 84,909,267	C826Y	probably benign	Het
Nbea	A	G	3: 56,002,797	W1326R	probably damaging	Het
Notch1	A	G	2: 26,459,533	*2532Q	probably null	Het
Npas2	A	G	1: 39,326,147	Y287C	probably damaging	Het
Olfr1016	T	A	2: 85,799,949	D107V	probably benign	Het
Olfr401	G	A	11: 74,121,837	D183N	probably damaging	Het
Pcdhga7	C	A	18: 37,716,024	D361E	possibly damaging	Het
Pde10a	T	A	17: 8,961,920	Y447N	possibly damaging	Het
Piwil2	T	A	14: 70,395,441	I561F	probably benign	Het
Pml	C	A	9: 58,234,685	R288L	probably benign	Het
Ppp4r4	A	G	12: 103,598,148	T591A	probably benign	Het
Ptprb	A	G	10: 116,315,251	T273A	probably benign	Het
Ptpro	T	A	6: 137,416,863	L843*	probably null	Het
Qrfpr	T	C	3: 36,189,602	I117V	probably benign	Het
Qrich2	T	C	11: 116,455,765	D1411G	probably benign	Het
Rad51ap2	T	C	12: 11,456,655	S193P	probably benign	Het
Raver1	T	C	9: 21,081,314	E273G	probably benign	Het
Rubcn	C	A	16: 32,868,274		probably benign	Het
S1pr4	C	T	10: 81,498,492	V383I	possibly damaging	Het
Scn7a	T	C	2: 66,676,150	D1465G	probably damaging	Het
Smarca4	T	A	9: 21,647,359	D607E	possibly damaging	Het
Srbd1	T	A	17: 85,985,454	I896L	possibly damaging	Het
Sulf2	G	T	2: 166,079,536	N722K	possibly damaging	Het
Surf1	A	G	2: 26,916,268	Y22H	probably benign	Het
Syngr2	A	G	11: 117,813,156	T150A	probably benign	Het
Szt2	G	T	4: 118,366,219	H3056N	unknown	Het
Tmf1	A	T	6: 97,161,411	S849T	probably benign	Het
Trio	G	T	15: 27,774,086	P1764Q	probably damaging	Het
Trpc3	A	T	3: 36,640,672	V711D	probably damaging	Het
Ttll3	G	T	6: 113,409,337	K710N	probably damaging	Het
Unc13c	A	G	9: 73,481,109	S2132P	possibly damaging	Het
Utp20	G	A	10: 88,801,136	P738S	possibly damaging	Het
Vmn2r76	C	T	7: 86,228,684	V502I	probably benign	Het
Vsig1	C	T	X: 140,933,126	H232Y	probably benign	Het
Wdr64	T	G	1: 175,763,945	F390V	probably damaging	Het
Ybx3	T	G	6: 131,367,863	T341P	possibly damaging	Het
Zdhhc11	C	A	13: 73,973,747	Q126K	possibly damaging	Het
Zfp777	G	A	6: 48,025,138	P673S	probably damaging	Het

Other mutations in Tns1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00954:Tns1	APN	1	73924969	missense	probably damaging	0.99
IGL01288:Tns1	APN	1	73953810	missense	probably damaging	1.00
IGL01536:Tns1	APN	1	73919648	splice site	probably benign
IGL01568:Tns1	APN	1	73953509	missense	probably damaging	1.00
IGL01683:Tns1	APN	1	73953269	missense	probably damaging	0.98
IGL02267:Tns1	APN	1	73992131	missense	possibly damaging	0.95
IGL02597:Tns1	APN	1	73985873	critical splice donor site	probably null
IGL02819:Tns1	APN	1	73937248	missense	probably damaging	0.99
IGL03370:Tns1	APN	1	73985894	missense	probably damaging	1.00
R0087:Tns1	UTSW	1	73916917	missense	possibly damaging	0.95
R0207:Tns1	UTSW	1	73937318	critical splice acceptor site	probably null
R0411:Tns1	UTSW	1	73925761	missense	probably damaging	0.96
R0543:Tns1	UTSW	1	73952697	missense	probably benign	0.01
R0552:Tns1	UTSW	1	73920563	missense	probably damaging	1.00
R0720:Tns1	UTSW	1	73925581	missense	probably benign	0.03
R0828:Tns1	UTSW	1	73919666	missense	probably damaging	1.00
R1034:Tns1	UTSW	1	73941969	missense	probably damaging	1.00
R1061:Tns1	UTSW	1	73917672	missense	probably damaging	1.00
R1819:Tns1	UTSW	1	73916476	splice site	probably benign
R1826:Tns1	UTSW	1	73953634	start codon destroyed	probably null	0.91
R2208:Tns1	UTSW	1	74079240	missense	probably damaging	1.00
R3723:Tns1	UTSW	1	73924940	missense	probably damaging	0.99
R4079:Tns1	UTSW	1	73995308	missense	probably damaging	1.00
R4111:Tns1	UTSW	1	73941932	missense	probably damaging	1.00
R4155:Tns1	UTSW	1	73914631	missense	probably damaging	1.00
R4156:Tns1	UTSW	1	73914631	missense	probably damaging	1.00
R4157:Tns1	UTSW	1	73914631	missense	probably damaging	1.00
R4274:Tns1	UTSW	1	73928098	missense	probably damaging	1.00
R4426:Tns1	UTSW	1	73985749	missense	probably damaging	0.97
R4649:Tns1	UTSW	1	73953771	missense	probably damaging	1.00
R4742:Tns1	UTSW	1	74124290	critical splice donor site	probably null
R4869:Tns1	UTSW	1	73952615	missense	probably benign
R4961:Tns1	UTSW	1	73935915	missense	probably benign	0.35
R5025:Tns1	UTSW	1	73925482	missense	probably damaging	1.00
R5035:Tns1	UTSW	1	73953820	start gained	probably benign
R5062:Tns1	UTSW	1	73952864	missense	probably damaging	1.00
R5080:Tns1	UTSW	1	73952940	missense	probably damaging	1.00
R5213:Tns1	UTSW	1	73953612	missense	probably damaging	1.00
R5256:Tns1	UTSW	1	73995426	intron	probably benign
R5368:Tns1	UTSW	1	73941017	missense	probably benign	0.07
R5391:Tns1	UTSW	1	73990409	splice site	probably null
R5587:Tns1	UTSW	1	73920596	missense	possibly damaging	0.94
R5735:Tns1	UTSW	1	73927979	missense	probably benign	0.00
R5855:Tns1	UTSW	1	73918033	missense	possibly damaging	0.83
R5999:Tns1	UTSW	1	73928097	nonsense	probably null
R6122:Tns1	UTSW	1	73952419	critical splice donor site	probably null
R6148:Tns1	UTSW	1	73953453	missense	probably damaging	1.00
R6457:Tns1	UTSW	1	73918050	missense	probably damaging	0.99
R6525:Tns1	UTSW	1	73953470	missense	probably damaging	1.00
R6712:Tns1	UTSW	1	74079301	nonsense	probably null
R6773:Tns1	UTSW	1	73919707	missense	probably damaging	1.00
R6825:Tns1	UTSW	1	74002323	nonsense	probably null
R7085:Tns1	UTSW	1	73925462	missense	probably benign	0.00
R7128:Tns1	UTSW	1	73995304	missense
R7209:Tns1	UTSW	1	73953915	missense	possibly damaging	0.68
R7348:Tns1	UTSW	1	73916917	missense	possibly damaging	0.95
R7570:Tns1	UTSW	1	73953479	missense	probably damaging	1.00
R7670:Tns1	UTSW	1	73952477	missense	possibly damaging	0.93
R7769:Tns1	UTSW	1	73953371	missense	probably damaging	0.99
R8052:Tns1	UTSW	1	73953437	missense	probably damaging	1.00
R8225:Tns1	UTSW	1	73985887	missense	probably damaging	1.00
R8244:Tns1	UTSW	1	73937251	missense	probably damaging	1.00
R8321:Tns1	UTSW	1	73985780	critical splice acceptor site	probably null
R8344:Tns1	UTSW	1	73985042	missense	probably damaging	1.00
R8378:Tns1	UTSW	1	73937246	missense	probably damaging	1.00
R8434:Tns1	UTSW	1	73925606	missense	probably benign	0.00
R8773:Tns1	UTSW	1	73937248	missense	probably damaging	0.99
R9211:Tns1	UTSW	1	73917789	missense	possibly damaging	0.63
R9251:Tns1	UTSW	1	73991696	missense	probably damaging	1.00
R9315:Tns1	UTSW	1	73940982	missense
R9411:Tns1	UTSW	1	73953503	missense	probably damaging	1.00
R9592:Tns1	UTSW	1	73990394	missense	probably damaging	1.00
R9658:Tns1	UTSW	1	73942023	missense	probably benign	0.14
R9658:Tns1	UTSW	1	73942024	missense	probably benign	0.08
Z1177:Tns1	UTSW	1	74002307	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- AACTAAGGCTCTTAGCTGAACAAC -3'
(R):5'- TCCATAGAACCCTGCCTTGG -3'

Sequencing Primer
(F):5'- TGAACAACAGTGGTGCAATCTC -3'
(R):5'- TTGGGCAGACTCCCCTTG -3'

Posted On

2019-12-20