Incidental Mutation 'R7833:Wdr64'
ID 605751
Institutional Source Beutler Lab
Gene Symbol Wdr64
Ensembl Gene ENSMUSG00000026523
Gene Name WD repeat domain 64
Synonyms 4930415O10Rik, 4930511H01Rik
MMRRC Submission 045887-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R7833 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 175526159-175643300 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 175591511 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 390 (F390V)
Ref Sequence ENSEMBL: ENSMUSP00000128678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094288] [ENSMUST00000171939] [ENSMUST00000194087] [ENSMUST00000194783]
AlphaFold Q9D565
Predicted Effect probably damaging
Transcript: ENSMUST00000094288
AA Change: F400V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000091846
Gene: ENSMUSG00000026523
AA Change: F400V

DomainStartEndE-ValueType
WD40 118 159 2.65e1 SMART
WD40 162 200 2.13e1 SMART
low complexity region 259 271 N/A INTRINSIC
Blast:WD40 277 316 5e-19 BLAST
WD40 323 361 2.4e-1 SMART
WD40 365 404 8.29e-1 SMART
WD40 407 449 1.7e2 SMART
WD40 457 493 1.19e1 SMART
WD40 497 538 4.55e-3 SMART
WD40 643 684 3.31e0 SMART
WD40 742 806 7.4e0 SMART
Blast:WD40 811 851 7e-17 BLAST
WD40 864 903 4.62e-4 SMART
Blast:XPGN 921 964 9e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000171939
AA Change: F390V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128678
Gene: ENSMUSG00000026523
AA Change: F390V

DomainStartEndE-ValueType
WD40 151 190 5.73e0 SMART
low complexity region 249 261 N/A INTRINSIC
Blast:WD40 267 306 4e-19 BLAST
WD40 313 351 2.4e-1 SMART
WD40 355 394 8.29e-1 SMART
WD40 397 439 1.7e2 SMART
WD40 447 483 1.19e1 SMART
WD40 487 528 4.55e-3 SMART
WD40 633 674 3.31e0 SMART
WD40 732 796 7.4e0 SMART
Blast:WD40 801 841 5e-17 BLAST
WD40 854 893 4.62e-4 SMART
Blast:XPGN 911 954 1e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000194087
AA Change: F390V

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141740
Gene: ENSMUSG00000026523
AA Change: F390V

DomainStartEndE-ValueType
WD40 151 190 3.6e-2 SMART
low complexity region 249 261 N/A INTRINSIC
Blast:WD40 267 305 5e-19 BLAST
WD40 313 351 1.5e-3 SMART
WD40 355 394 5.2e-3 SMART
WD40 397 439 1.1e0 SMART
WD40 447 483 7.6e-2 SMART
WD40 487 528 2.9e-5 SMART
WD40 633 674 2.1e-2 SMART
WD40 732 796 4.7e-2 SMART
Blast:WD40 801 841 6e-17 BLAST
WD40 854 893 2.9e-6 SMART
Blast:XPGN 911 954 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194783
SMART Domains Protein: ENSMUSP00000141384
Gene: ENSMUSG00000026523

DomainStartEndE-ValueType
WD40 6 42 7.6e-2 SMART
WD40 46 87 2.9e-5 SMART
WD40 192 233 2.1e-2 SMART
WD40 291 355 4.7e-2 SMART
Blast:WD40 360 400 4e-17 BLAST
WD40 413 452 2.9e-6 SMART
Blast:XPGN 470 519 3e-19 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (71/71)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,902,059 (GRCm39) S578T possibly damaging Het
Acot5 A G 12: 84,122,601 (GRCm39) Q395R probably damaging Het
Adamts15 T A 9: 30,833,401 (GRCm39) T45S probably benign Het
Agbl2 A G 2: 90,645,777 (GRCm39) K837E probably benign Het
Atf2 T C 2: 73,684,229 (GRCm39) T19A possibly damaging Het
Atp6v0a2 T C 5: 124,782,969 (GRCm39) V238A probably damaging Het
Atp9a A T 2: 168,516,777 (GRCm39) V430E probably benign Het
Cachd1 G A 4: 100,832,012 (GRCm39) V725I probably benign Het
Ccnb1 G A 13: 100,917,859 (GRCm39) T247M probably damaging Het
Cd40 A T 2: 164,908,431 (GRCm39) D169V probably benign Het
Cdc25c G A 18: 34,880,296 (GRCm39) T146I probably benign Het
Cdhr18 A T 14: 13,896,968 (GRCm38) probably null Het
Ceacam3 C A 7: 16,893,778 (GRCm39) Q430K Het
Cerkl G A 2: 79,171,724 (GRCm39) T378I probably benign Het
Cpn2 G T 16: 30,079,163 (GRCm39) N179K probably damaging Het
Duox1 A G 2: 122,154,869 (GRCm39) D418G probably damaging Het
Eif1ad13 G A 12: 87,762,322 (GRCm39) R14K unknown Het
Eps8l1 C A 7: 4,471,866 (GRCm39) P11T possibly damaging Het
Erc1 C T 6: 119,801,447 (GRCm39) W190* probably null Het
Exosc7 A T 9: 122,959,984 (GRCm39) E195V probably benign Het
F2rl2 A G 13: 95,837,426 (GRCm39) N157S probably damaging Het
Fgd2 T C 17: 29,586,369 (GRCm39) L270P possibly damaging Het
Fitm2 A T 2: 163,312,019 (GRCm39) W65R probably damaging Het
Gabbr1 T G 17: 37,367,861 (GRCm39) I437S possibly damaging Het
Galntl6 A T 8: 58,310,571 (GRCm39) S377T probably benign Het
Gml2 T A 15: 74,693,217 (GRCm39) C73* probably null Het
Htr6 G T 4: 138,789,142 (GRCm39) F304L probably damaging Het
Hydin G A 8: 111,316,092 (GRCm39) G4328D probably damaging Het
Kcnj14 T C 7: 45,467,317 (GRCm39) D343G probably damaging Het
Klhdc1 T A 12: 69,329,942 (GRCm39) I357N probably benign Het
Lcor A G 19: 41,573,024 (GRCm39) D593G probably benign Het
Man2a1 A G 17: 64,973,746 (GRCm39) T341A probably damaging Het
Mrm1 A C 11: 84,709,469 (GRCm39) V196G probably damaging Het
Mybbp1a A G 11: 72,333,727 (GRCm39) probably null Het
Myo19 G A 11: 84,800,093 (GRCm39) C826Y probably benign Het
Nbea A G 3: 55,910,218 (GRCm39) W1326R probably damaging Het
Notch1 A G 2: 26,349,545 (GRCm39) *2532Q probably null Het
Npas2 A G 1: 39,365,228 (GRCm39) Y287C probably damaging Het
Or3a1b G A 11: 74,012,663 (GRCm39) D183N probably damaging Het
Or9g20 T A 2: 85,630,293 (GRCm39) D107V probably benign Het
Pate7 T A 9: 35,688,406 (GRCm39) S60C probably damaging Het
Pcdhga7 C A 18: 37,849,077 (GRCm39) D361E possibly damaging Het
Pde10a T A 17: 9,180,752 (GRCm39) Y447N possibly damaging Het
Piwil2 T A 14: 70,632,890 (GRCm39) I561F probably benign Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Ppp4r4 A G 12: 103,564,407 (GRCm39) T591A probably benign Het
Prxl2c T C 13: 64,460,092 (GRCm39) S84G probably benign Het
Ptprb A G 10: 116,151,156 (GRCm39) T273A probably benign Het
Ptpro T A 6: 137,393,861 (GRCm39) L843* probably null Het
Qrfpr T C 3: 36,243,751 (GRCm39) I117V probably benign Het
Qrich2 T C 11: 116,346,591 (GRCm39) D1411G probably benign Het
Rad51ap2 T C 12: 11,506,656 (GRCm39) S193P probably benign Het
Raver1 T C 9: 20,992,610 (GRCm39) E273G probably benign Het
Rubcn C A 16: 32,688,644 (GRCm39) probably benign Het
S1pr4 C T 10: 81,334,326 (GRCm39) V383I possibly damaging Het
Scn7a T C 2: 66,506,494 (GRCm39) D1465G probably damaging Het
Smarca4 T A 9: 21,558,655 (GRCm39) D607E possibly damaging Het
Srbd1 T A 17: 86,292,882 (GRCm39) I896L possibly damaging Het
Sulf2 G T 2: 165,921,456 (GRCm39) N722K possibly damaging Het
Surf1 A G 2: 26,806,280 (GRCm39) Y22H probably benign Het
Syngr2 A G 11: 117,703,982 (GRCm39) T150A probably benign Het
Szt2 G T 4: 118,223,416 (GRCm39) H3056N unknown Het
Tmf1 A T 6: 97,138,372 (GRCm39) S849T probably benign Het
Tns1 T A 1: 74,130,490 (GRCm39) probably benign Het
Trio G T 15: 27,774,172 (GRCm39) P1764Q probably damaging Het
Trpc3 A T 3: 36,694,821 (GRCm39) V711D probably damaging Het
Ttll3 G T 6: 113,386,298 (GRCm39) K710N probably damaging Het
Unc13c A G 9: 73,388,391 (GRCm39) S2132P possibly damaging Het
Utp20 G A 10: 88,636,998 (GRCm39) P738S possibly damaging Het
Vmn2r76 C T 7: 85,877,892 (GRCm39) V502I probably benign Het
Vsig1 C T X: 139,833,875 (GRCm39) H232Y probably benign Het
Ybx3 T G 6: 131,344,826 (GRCm39) T341P possibly damaging Het
Zdhhc11 C A 13: 74,121,866 (GRCm39) Q126K possibly damaging Het
Zfp777 G A 6: 48,002,072 (GRCm39) P673S probably damaging Het
Other mutations in Wdr64
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Wdr64 APN 1 175,526,366 (GRCm39) missense probably benign 0.00
IGL00902:Wdr64 APN 1 175,556,391 (GRCm39) missense probably damaging 1.00
IGL01347:Wdr64 APN 1 175,547,899 (GRCm39) missense probably benign 0.12
IGL01353:Wdr64 APN 1 175,559,151 (GRCm39) missense probably damaging 0.96
IGL01583:Wdr64 APN 1 175,594,722 (GRCm39) critical splice donor site probably null
IGL01643:Wdr64 APN 1 175,599,877 (GRCm39) missense probably damaging 1.00
IGL01673:Wdr64 APN 1 175,627,922 (GRCm39) missense possibly damaging 0.68
IGL01992:Wdr64 APN 1 175,533,637 (GRCm39) missense probably damaging 1.00
IGL02613:Wdr64 APN 1 175,594,613 (GRCm39) nonsense probably null
IGL02834:Wdr64 APN 1 175,633,415 (GRCm39) splice site probably benign
IGL03214:Wdr64 APN 1 175,571,201 (GRCm39) splice site probably benign
IGL03305:Wdr64 APN 1 175,583,152 (GRCm39) missense possibly damaging 0.94
IGL03308:Wdr64 APN 1 175,594,562 (GRCm39) unclassified probably benign
PIT4418001:Wdr64 UTSW 1 175,571,160 (GRCm39) nonsense probably null
R0036:Wdr64 UTSW 1 175,556,496 (GRCm39) nonsense probably null
R0041:Wdr64 UTSW 1 175,554,037 (GRCm39) nonsense probably null
R0041:Wdr64 UTSW 1 175,554,037 (GRCm39) nonsense probably null
R0079:Wdr64 UTSW 1 175,622,668 (GRCm39) missense probably benign 0.02
R0380:Wdr64 UTSW 1 175,597,208 (GRCm39) splice site probably benign
R0486:Wdr64 UTSW 1 175,622,769 (GRCm39) splice site probably benign
R0520:Wdr64 UTSW 1 175,553,958 (GRCm39) missense probably damaging 1.00
R0598:Wdr64 UTSW 1 175,633,465 (GRCm39) missense probably damaging 1.00
R0711:Wdr64 UTSW 1 175,599,751 (GRCm39) missense probably benign 0.39
R0746:Wdr64 UTSW 1 175,620,539 (GRCm39) missense possibly damaging 0.92
R0927:Wdr64 UTSW 1 175,620,647 (GRCm39) missense probably damaging 0.97
R0947:Wdr64 UTSW 1 175,603,315 (GRCm39) missense probably benign
R1014:Wdr64 UTSW 1 175,583,192 (GRCm39) missense probably damaging 1.00
R1332:Wdr64 UTSW 1 175,622,706 (GRCm39) missense possibly damaging 0.82
R1416:Wdr64 UTSW 1 175,633,568 (GRCm39) missense probably benign 0.01
R1421:Wdr64 UTSW 1 175,594,716 (GRCm39) missense possibly damaging 0.85
R1467:Wdr64 UTSW 1 175,603,288 (GRCm39) missense probably benign 0.00
R1467:Wdr64 UTSW 1 175,603,288 (GRCm39) missense probably benign 0.00
R1796:Wdr64 UTSW 1 175,544,897 (GRCm39) missense probably damaging 1.00
R1797:Wdr64 UTSW 1 175,639,585 (GRCm39) missense probably damaging 1.00
R2145:Wdr64 UTSW 1 175,594,661 (GRCm39) missense probably benign 0.01
R2321:Wdr64 UTSW 1 175,622,653 (GRCm39) missense possibly damaging 0.57
R2449:Wdr64 UTSW 1 175,526,479 (GRCm39) missense probably benign
R4049:Wdr64 UTSW 1 175,633,422 (GRCm39) missense probably benign 0.21
R4155:Wdr64 UTSW 1 175,597,172 (GRCm39) missense probably benign 0.03
R4624:Wdr64 UTSW 1 175,599,829 (GRCm39) missense probably benign
R4661:Wdr64 UTSW 1 175,554,060 (GRCm39) missense probably damaging 1.00
R4711:Wdr64 UTSW 1 175,626,795 (GRCm39) missense probably damaging 1.00
R4891:Wdr64 UTSW 1 175,526,345 (GRCm39) unclassified probably benign
R4925:Wdr64 UTSW 1 175,552,268 (GRCm39) splice site probably null
R4943:Wdr64 UTSW 1 175,547,882 (GRCm39) missense probably benign 0.01
R5000:Wdr64 UTSW 1 175,553,941 (GRCm39) splice site probably null
R5001:Wdr64 UTSW 1 175,620,525 (GRCm39) critical splice acceptor site probably null
R5143:Wdr64 UTSW 1 175,553,979 (GRCm39) missense probably damaging 1.00
R5395:Wdr64 UTSW 1 175,583,164 (GRCm39) missense probably damaging 1.00
R5813:Wdr64 UTSW 1 175,639,623 (GRCm39) missense possibly damaging 0.89
R6014:Wdr64 UTSW 1 175,633,556 (GRCm39) missense possibly damaging 0.56
R6417:Wdr64 UTSW 1 175,553,956 (GRCm39) missense probably damaging 1.00
R6456:Wdr64 UTSW 1 175,613,175 (GRCm39) critical splice donor site probably null
R6555:Wdr64 UTSW 1 175,547,856 (GRCm39) missense probably damaging 1.00
R6576:Wdr64 UTSW 1 175,633,494 (GRCm39) missense possibly damaging 0.82
R6797:Wdr64 UTSW 1 175,638,176 (GRCm39) critical splice donor site probably null
R6891:Wdr64 UTSW 1 175,533,634 (GRCm39) missense probably damaging 1.00
R6959:Wdr64 UTSW 1 175,533,555 (GRCm39) missense probably damaging 1.00
R7205:Wdr64 UTSW 1 175,617,499 (GRCm39) missense probably benign 0.34
R7252:Wdr64 UTSW 1 175,603,240 (GRCm39) missense probably benign 0.00
R7552:Wdr64 UTSW 1 175,613,147 (GRCm39) missense possibly damaging 0.71
R7732:Wdr64 UTSW 1 175,617,495 (GRCm39) missense probably benign
R7777:Wdr64 UTSW 1 175,617,564 (GRCm39) missense possibly damaging 0.71
R7780:Wdr64 UTSW 1 175,556,542 (GRCm39) missense probably damaging 1.00
R7810:Wdr64 UTSW 1 175,559,092 (GRCm39) missense probably benign 0.01
R7843:Wdr64 UTSW 1 175,639,668 (GRCm39) missense probably benign 0.00
R7887:Wdr64 UTSW 1 175,613,111 (GRCm39) missense not run
R7991:Wdr64 UTSW 1 175,554,051 (GRCm39) missense probably benign 0.36
R8124:Wdr64 UTSW 1 175,626,844 (GRCm39) splice site probably null
R8129:Wdr64 UTSW 1 175,603,154 (GRCm39) missense probably damaging 0.96
R8673:Wdr64 UTSW 1 175,633,584 (GRCm39) missense probably damaging 1.00
R8728:Wdr64 UTSW 1 175,559,079 (GRCm39) missense probably benign 0.01
R8786:Wdr64 UTSW 1 175,636,327 (GRCm39) nonsense probably null
R8822:Wdr64 UTSW 1 175,544,920 (GRCm39) missense probably damaging 1.00
R8842:Wdr64 UTSW 1 175,599,893 (GRCm39) missense probably benign 0.02
R8887:Wdr64 UTSW 1 175,599,850 (GRCm39) missense probably benign 0.17
R9014:Wdr64 UTSW 1 175,526,395 (GRCm39) missense probably benign
R9330:Wdr64 UTSW 1 175,554,024 (GRCm39) missense possibly damaging 0.93
R9332:Wdr64 UTSW 1 175,599,871 (GRCm39) missense possibly damaging 0.71
R9465:Wdr64 UTSW 1 175,618,823 (GRCm39) missense possibly damaging 0.53
R9716:Wdr64 UTSW 1 175,622,658 (GRCm39) missense probably benign
R9717:Wdr64 UTSW 1 175,544,854 (GRCm39) missense probably damaging 1.00
Z1088:Wdr64 UTSW 1 175,533,551 (GRCm39) missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AAATCCAGTGGCTAGGGACATAC -3'
(R):5'- AGAGTTCAAGAGCTATCTTTTCGAG -3'

Sequencing Primer
(F):5'- TGGCTAGGGACATACCTTTAAGC -3'
(R):5'- TCAAGAGCTATCTTTTCGAGAAAATG -3'
Posted On 2019-12-20