Incidental Mutation 'R7833:Atf2'
ID 605755
Institutional Source Beutler Lab
Gene Symbol Atf2
Ensembl Gene ENSMUSG00000027104
Gene Name activating transcription factor 2
Synonyms mXBP, ATF-2, CRE-BP, D130078H02Rik, Creb2
MMRRC Submission 045887-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.935) question?
Stock # R7833 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 73646853-73722983 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73684229 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 19 (T19A)
Ref Sequence ENSEMBL: ENSMUSP00000107647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055833] [ENSMUST00000090802] [ENSMUST00000100009] [ENSMUST00000112007] [ENSMUST00000112010] [ENSMUST00000112016] [ENSMUST00000112017] [ENSMUST00000128531] [ENSMUST00000136958] [ENSMUST00000154456] [ENSMUST00000173010]
AlphaFold P16951
Predicted Effect possibly damaging
Transcript: ENSMUST00000055833
AA Change: T19A

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058521
Gene: ENSMUSG00000027104
AA Change: T19A

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 396 3.15e-21 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090802
SMART Domains Protein: ENSMUSP00000088311
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
low complexity region 197 214 N/A INTRINSIC
low complexity region 260 276 N/A INTRINSIC
BRLZ 292 356 3.15e-21 SMART
low complexity region 397 409 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100009
AA Change: T19A

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097588
Gene: ENSMUSG00000027104
AA Change: T19A

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 396 3.15e-21 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112007
SMART Domains Protein: ENSMUSP00000107638
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
low complexity region 197 214 N/A INTRINSIC
low complexity region 260 276 N/A INTRINSIC
BRLZ 292 356 3.15e-21 SMART
low complexity region 397 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112010
SMART Domains Protein: ENSMUSP00000107641
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
low complexity region 197 214 N/A INTRINSIC
low complexity region 260 276 N/A INTRINSIC
BRLZ 292 356 3.15e-21 SMART
low complexity region 397 409 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112016
AA Change: T19A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107647
Gene: ENSMUSG00000027104
AA Change: T19A

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 139 156 N/A INTRINSIC
low complexity region 202 218 N/A INTRINSIC
BRLZ 234 298 3.15e-21 SMART
low complexity region 339 351 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112017
AA Change: T19A

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107648
Gene: ENSMUSG00000027104
AA Change: T19A

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 396 3.15e-21 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000128531
AA Change: T19A

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118560
Gene: ENSMUSG00000027104
AA Change: T19A

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000136958
AA Change: T19A

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118357
Gene: ENSMUSG00000027104
AA Change: T19A

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 139 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154456
Predicted Effect possibly damaging
Transcript: ENSMUST00000173010
AA Change: T19A

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133632
Gene: ENSMUSG00000027104
AA Change: T19A

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 377 1.32e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions This protein binds to the cAMP-responsive element (CRE), an octameric palindrome. It forms a homodimer or a heterodimer with c-Jun and stimulates CRE-dependent transcription. This protein is also a histone acetyltransferase (HAT) that specifically acetylates histones H2B and H4 in vitro; thus it may represent a class of sequence-specific factors that activate transcription by direct effects on chromatin components. The encoded protein may also be involved in cell's DNA damage response independent of its role in transcriptional regulation. Several alternatively spliced transcript variants have been found for this gene [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous mutation of this gene results in increased postnatal lethality, skeletal development defects, runting, decreased hearing, inner ear and brain abnormalities, hyperactivity, and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,902,059 (GRCm39) S578T possibly damaging Het
Acot5 A G 12: 84,122,601 (GRCm39) Q395R probably damaging Het
Adamts15 T A 9: 30,833,401 (GRCm39) T45S probably benign Het
Agbl2 A G 2: 90,645,777 (GRCm39) K837E probably benign Het
Atp6v0a2 T C 5: 124,782,969 (GRCm39) V238A probably damaging Het
Atp9a A T 2: 168,516,777 (GRCm39) V430E probably benign Het
Cachd1 G A 4: 100,832,012 (GRCm39) V725I probably benign Het
Ccnb1 G A 13: 100,917,859 (GRCm39) T247M probably damaging Het
Cd40 A T 2: 164,908,431 (GRCm39) D169V probably benign Het
Cdc25c G A 18: 34,880,296 (GRCm39) T146I probably benign Het
Cdhr18 A T 14: 13,896,968 (GRCm38) probably null Het
Ceacam3 C A 7: 16,893,778 (GRCm39) Q430K Het
Cerkl G A 2: 79,171,724 (GRCm39) T378I probably benign Het
Cpn2 G T 16: 30,079,163 (GRCm39) N179K probably damaging Het
Duox1 A G 2: 122,154,869 (GRCm39) D418G probably damaging Het
Eif1ad13 G A 12: 87,762,322 (GRCm39) R14K unknown Het
Eps8l1 C A 7: 4,471,866 (GRCm39) P11T possibly damaging Het
Erc1 C T 6: 119,801,447 (GRCm39) W190* probably null Het
Exosc7 A T 9: 122,959,984 (GRCm39) E195V probably benign Het
F2rl2 A G 13: 95,837,426 (GRCm39) N157S probably damaging Het
Fgd2 T C 17: 29,586,369 (GRCm39) L270P possibly damaging Het
Fitm2 A T 2: 163,312,019 (GRCm39) W65R probably damaging Het
Gabbr1 T G 17: 37,367,861 (GRCm39) I437S possibly damaging Het
Galntl6 A T 8: 58,310,571 (GRCm39) S377T probably benign Het
Gml2 T A 15: 74,693,217 (GRCm39) C73* probably null Het
Htr6 G T 4: 138,789,142 (GRCm39) F304L probably damaging Het
Hydin G A 8: 111,316,092 (GRCm39) G4328D probably damaging Het
Kcnj14 T C 7: 45,467,317 (GRCm39) D343G probably damaging Het
Klhdc1 T A 12: 69,329,942 (GRCm39) I357N probably benign Het
Lcor A G 19: 41,573,024 (GRCm39) D593G probably benign Het
Man2a1 A G 17: 64,973,746 (GRCm39) T341A probably damaging Het
Mrm1 A C 11: 84,709,469 (GRCm39) V196G probably damaging Het
Mybbp1a A G 11: 72,333,727 (GRCm39) probably null Het
Myo19 G A 11: 84,800,093 (GRCm39) C826Y probably benign Het
Nbea A G 3: 55,910,218 (GRCm39) W1326R probably damaging Het
Notch1 A G 2: 26,349,545 (GRCm39) *2532Q probably null Het
Npas2 A G 1: 39,365,228 (GRCm39) Y287C probably damaging Het
Or3a1b G A 11: 74,012,663 (GRCm39) D183N probably damaging Het
Or9g20 T A 2: 85,630,293 (GRCm39) D107V probably benign Het
Pate7 T A 9: 35,688,406 (GRCm39) S60C probably damaging Het
Pcdhga7 C A 18: 37,849,077 (GRCm39) D361E possibly damaging Het
Pde10a T A 17: 9,180,752 (GRCm39) Y447N possibly damaging Het
Piwil2 T A 14: 70,632,890 (GRCm39) I561F probably benign Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Ppp4r4 A G 12: 103,564,407 (GRCm39) T591A probably benign Het
Prxl2c T C 13: 64,460,092 (GRCm39) S84G probably benign Het
Ptprb A G 10: 116,151,156 (GRCm39) T273A probably benign Het
Ptpro T A 6: 137,393,861 (GRCm39) L843* probably null Het
Qrfpr T C 3: 36,243,751 (GRCm39) I117V probably benign Het
Qrich2 T C 11: 116,346,591 (GRCm39) D1411G probably benign Het
Rad51ap2 T C 12: 11,506,656 (GRCm39) S193P probably benign Het
Raver1 T C 9: 20,992,610 (GRCm39) E273G probably benign Het
Rubcn C A 16: 32,688,644 (GRCm39) probably benign Het
S1pr4 C T 10: 81,334,326 (GRCm39) V383I possibly damaging Het
Scn7a T C 2: 66,506,494 (GRCm39) D1465G probably damaging Het
Smarca4 T A 9: 21,558,655 (GRCm39) D607E possibly damaging Het
Srbd1 T A 17: 86,292,882 (GRCm39) I896L possibly damaging Het
Sulf2 G T 2: 165,921,456 (GRCm39) N722K possibly damaging Het
Surf1 A G 2: 26,806,280 (GRCm39) Y22H probably benign Het
Syngr2 A G 11: 117,703,982 (GRCm39) T150A probably benign Het
Szt2 G T 4: 118,223,416 (GRCm39) H3056N unknown Het
Tmf1 A T 6: 97,138,372 (GRCm39) S849T probably benign Het
Tns1 T A 1: 74,130,490 (GRCm39) probably benign Het
Trio G T 15: 27,774,172 (GRCm39) P1764Q probably damaging Het
Trpc3 A T 3: 36,694,821 (GRCm39) V711D probably damaging Het
Ttll3 G T 6: 113,386,298 (GRCm39) K710N probably damaging Het
Unc13c A G 9: 73,388,391 (GRCm39) S2132P possibly damaging Het
Utp20 G A 10: 88,636,998 (GRCm39) P738S possibly damaging Het
Vmn2r76 C T 7: 85,877,892 (GRCm39) V502I probably benign Het
Vsig1 C T X: 139,833,875 (GRCm39) H232Y probably benign Het
Wdr64 T G 1: 175,591,511 (GRCm39) F390V probably damaging Het
Ybx3 T G 6: 131,344,826 (GRCm39) T341P possibly damaging Het
Zdhhc11 C A 13: 74,121,866 (GRCm39) Q126K possibly damaging Het
Zfp777 G A 6: 48,002,072 (GRCm39) P673S probably damaging Het
Other mutations in Atf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Atf2 APN 2 73,675,847 (GRCm39) missense possibly damaging 0.85
IGL01608:Atf2 APN 2 73,649,422 (GRCm39) missense probably damaging 1.00
IGL02112:Atf2 APN 2 73,649,381 (GRCm39) missense probably damaging 1.00
IGL02469:Atf2 APN 2 73,676,676 (GRCm39) missense probably damaging 0.99
IGL02686:Atf2 APN 2 73,675,844 (GRCm39) missense possibly damaging 0.90
IGL03381:Atf2 APN 2 73,659,012 (GRCm39) missense probably benign 0.13
R0020:Atf2 UTSW 2 73,676,628 (GRCm39) missense possibly damaging 0.81
R0020:Atf2 UTSW 2 73,676,628 (GRCm39) missense possibly damaging 0.81
R0045:Atf2 UTSW 2 73,660,200 (GRCm39) missense probably benign 0.02
R0045:Atf2 UTSW 2 73,660,200 (GRCm39) missense probably benign 0.02
R0480:Atf2 UTSW 2 73,649,500 (GRCm39) splice site probably benign
R0732:Atf2 UTSW 2 73,675,844 (GRCm39) missense possibly damaging 0.90
R1188:Atf2 UTSW 2 73,675,881 (GRCm39) missense probably damaging 0.96
R1285:Atf2 UTSW 2 73,675,853 (GRCm39) missense probably damaging 1.00
R1287:Atf2 UTSW 2 73,675,853 (GRCm39) missense probably damaging 1.00
R1523:Atf2 UTSW 2 73,693,552 (GRCm39) missense probably damaging 1.00
R1622:Atf2 UTSW 2 73,684,133 (GRCm39) splice site probably null
R1731:Atf2 UTSW 2 73,675,853 (GRCm39) missense probably damaging 1.00
R1935:Atf2 UTSW 2 73,676,563 (GRCm39) missense probably damaging 1.00
R1939:Atf2 UTSW 2 73,676,563 (GRCm39) missense probably damaging 1.00
R1965:Atf2 UTSW 2 73,681,242 (GRCm39) missense possibly damaging 0.87
R2000:Atf2 UTSW 2 73,693,584 (GRCm39) critical splice acceptor site probably null
R2045:Atf2 UTSW 2 73,693,552 (GRCm39) missense probably damaging 1.00
R2256:Atf2 UTSW 2 73,675,855 (GRCm39) splice site probably null
R3147:Atf2 UTSW 2 73,681,283 (GRCm39) splice site probably null
R3890:Atf2 UTSW 2 73,693,557 (GRCm39) missense probably damaging 1.00
R4680:Atf2 UTSW 2 73,659,025 (GRCm39) splice site probably null
R4715:Atf2 UTSW 2 73,653,644 (GRCm39) missense probably damaging 1.00
R5161:Atf2 UTSW 2 73,660,134 (GRCm39) critical splice donor site probably null
R5853:Atf2 UTSW 2 73,658,813 (GRCm39) splice site probably null
R7419:Atf2 UTSW 2 73,672,777 (GRCm39) missense probably benign 0.01
R9202:Atf2 UTSW 2 73,649,472 (GRCm39) missense probably damaging 0.99
R9266:Atf2 UTSW 2 73,649,271 (GRCm39) missense probably benign 0.27
R9690:Atf2 UTSW 2 73,675,813 (GRCm39) missense probably benign 0.26
X0033:Atf2 UTSW 2 73,676,625 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GAAGCAATTGGACTATCACCAG -3'
(R):5'- CAGGTCGCTCAGATGAGTTATATAC -3'

Sequencing Primer
(F):5'- GCAATTGGACTATCACCAGACTATAG -3'
(R):5'- GTGGGTTTCTCTGATTATTTGAAAAC -3'
Posted On 2019-12-20