Incidental Mutation 'R7833:Cerkl'
ID 605756
Institutional Source Beutler Lab
Gene Symbol Cerkl
Ensembl Gene ENSMUSG00000075256
Gene Name ceramide kinase-like
Synonyms Rp26
MMRRC Submission 045887-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.402) question?
Stock # R7833 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 79162835-79259332 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 79171724 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 378 (T378I)
Ref Sequence ENSEMBL: ENSMUSP00000114325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143974] [ENSMUST00000156731]
AlphaFold A2AQH1
Predicted Effect probably benign
Transcript: ENSMUST00000143974
AA Change: T378I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000114325
Gene: ENSMUSG00000075256
AA Change: T378I

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 70 80 N/A INTRINSIC
Pfam:DAGK_cat 152 293 2.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156731
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was initially identified as a locus (RP26) associated with an autosomal recessive form of retinitis pigmentosa (arRP) disease. This gene encodes a protein with ceramide kinase-like domains, however, the protein does not phosphorylate ceramide and its target substrate is currently unknown. This protein may be a negative regulator of apoptosis in photoreceptor cells. Mutations in this gene cause a form of retinitis pigmentosa characterized by autosomal recessive cone and rod dystrophy (arCRD). Alternative splicing of this gene results in multiple transcript variants encoding different isoforms and non-coding transcripts.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit retinal apoptosis and decreased amplitudes and increased implicit time of oscillatory potentials. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,902,059 (GRCm39) S578T possibly damaging Het
Acot5 A G 12: 84,122,601 (GRCm39) Q395R probably damaging Het
Adamts15 T A 9: 30,833,401 (GRCm39) T45S probably benign Het
Agbl2 A G 2: 90,645,777 (GRCm39) K837E probably benign Het
Atf2 T C 2: 73,684,229 (GRCm39) T19A possibly damaging Het
Atp6v0a2 T C 5: 124,782,969 (GRCm39) V238A probably damaging Het
Atp9a A T 2: 168,516,777 (GRCm39) V430E probably benign Het
Cachd1 G A 4: 100,832,012 (GRCm39) V725I probably benign Het
Ccnb1 G A 13: 100,917,859 (GRCm39) T247M probably damaging Het
Cd40 A T 2: 164,908,431 (GRCm39) D169V probably benign Het
Cdc25c G A 18: 34,880,296 (GRCm39) T146I probably benign Het
Cdhr18 A T 14: 13,896,968 (GRCm38) probably null Het
Ceacam3 C A 7: 16,893,778 (GRCm39) Q430K Het
Cpn2 G T 16: 30,079,163 (GRCm39) N179K probably damaging Het
Duox1 A G 2: 122,154,869 (GRCm39) D418G probably damaging Het
Eif1ad13 G A 12: 87,762,322 (GRCm39) R14K unknown Het
Eps8l1 C A 7: 4,471,866 (GRCm39) P11T possibly damaging Het
Erc1 C T 6: 119,801,447 (GRCm39) W190* probably null Het
Exosc7 A T 9: 122,959,984 (GRCm39) E195V probably benign Het
F2rl2 A G 13: 95,837,426 (GRCm39) N157S probably damaging Het
Fgd2 T C 17: 29,586,369 (GRCm39) L270P possibly damaging Het
Fitm2 A T 2: 163,312,019 (GRCm39) W65R probably damaging Het
Gabbr1 T G 17: 37,367,861 (GRCm39) I437S possibly damaging Het
Galntl6 A T 8: 58,310,571 (GRCm39) S377T probably benign Het
Gml2 T A 15: 74,693,217 (GRCm39) C73* probably null Het
Htr6 G T 4: 138,789,142 (GRCm39) F304L probably damaging Het
Hydin G A 8: 111,316,092 (GRCm39) G4328D probably damaging Het
Kcnj14 T C 7: 45,467,317 (GRCm39) D343G probably damaging Het
Klhdc1 T A 12: 69,329,942 (GRCm39) I357N probably benign Het
Lcor A G 19: 41,573,024 (GRCm39) D593G probably benign Het
Man2a1 A G 17: 64,973,746 (GRCm39) T341A probably damaging Het
Mrm1 A C 11: 84,709,469 (GRCm39) V196G probably damaging Het
Mybbp1a A G 11: 72,333,727 (GRCm39) probably null Het
Myo19 G A 11: 84,800,093 (GRCm39) C826Y probably benign Het
Nbea A G 3: 55,910,218 (GRCm39) W1326R probably damaging Het
Notch1 A G 2: 26,349,545 (GRCm39) *2532Q probably null Het
Npas2 A G 1: 39,365,228 (GRCm39) Y287C probably damaging Het
Or3a1b G A 11: 74,012,663 (GRCm39) D183N probably damaging Het
Or9g20 T A 2: 85,630,293 (GRCm39) D107V probably benign Het
Pate7 T A 9: 35,688,406 (GRCm39) S60C probably damaging Het
Pcdhga7 C A 18: 37,849,077 (GRCm39) D361E possibly damaging Het
Pde10a T A 17: 9,180,752 (GRCm39) Y447N possibly damaging Het
Piwil2 T A 14: 70,632,890 (GRCm39) I561F probably benign Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Ppp4r4 A G 12: 103,564,407 (GRCm39) T591A probably benign Het
Prxl2c T C 13: 64,460,092 (GRCm39) S84G probably benign Het
Ptprb A G 10: 116,151,156 (GRCm39) T273A probably benign Het
Ptpro T A 6: 137,393,861 (GRCm39) L843* probably null Het
Qrfpr T C 3: 36,243,751 (GRCm39) I117V probably benign Het
Qrich2 T C 11: 116,346,591 (GRCm39) D1411G probably benign Het
Rad51ap2 T C 12: 11,506,656 (GRCm39) S193P probably benign Het
Raver1 T C 9: 20,992,610 (GRCm39) E273G probably benign Het
Rubcn C A 16: 32,688,644 (GRCm39) probably benign Het
S1pr4 C T 10: 81,334,326 (GRCm39) V383I possibly damaging Het
Scn7a T C 2: 66,506,494 (GRCm39) D1465G probably damaging Het
Smarca4 T A 9: 21,558,655 (GRCm39) D607E possibly damaging Het
Srbd1 T A 17: 86,292,882 (GRCm39) I896L possibly damaging Het
Sulf2 G T 2: 165,921,456 (GRCm39) N722K possibly damaging Het
Surf1 A G 2: 26,806,280 (GRCm39) Y22H probably benign Het
Syngr2 A G 11: 117,703,982 (GRCm39) T150A probably benign Het
Szt2 G T 4: 118,223,416 (GRCm39) H3056N unknown Het
Tmf1 A T 6: 97,138,372 (GRCm39) S849T probably benign Het
Tns1 T A 1: 74,130,490 (GRCm39) probably benign Het
Trio G T 15: 27,774,172 (GRCm39) P1764Q probably damaging Het
Trpc3 A T 3: 36,694,821 (GRCm39) V711D probably damaging Het
Ttll3 G T 6: 113,386,298 (GRCm39) K710N probably damaging Het
Unc13c A G 9: 73,388,391 (GRCm39) S2132P possibly damaging Het
Utp20 G A 10: 88,636,998 (GRCm39) P738S possibly damaging Het
Vmn2r76 C T 7: 85,877,892 (GRCm39) V502I probably benign Het
Vsig1 C T X: 139,833,875 (GRCm39) H232Y probably benign Het
Wdr64 T G 1: 175,591,511 (GRCm39) F390V probably damaging Het
Ybx3 T G 6: 131,344,826 (GRCm39) T341P possibly damaging Het
Zdhhc11 C A 13: 74,121,866 (GRCm39) Q126K possibly damaging Het
Zfp777 G A 6: 48,002,072 (GRCm39) P673S probably damaging Het
Other mutations in Cerkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Cerkl APN 2 79,171,843 (GRCm39) missense probably benign 0.00
IGL01330:Cerkl APN 2 79,199,125 (GRCm39) missense possibly damaging 0.90
IGL01468:Cerkl APN 2 79,173,559 (GRCm39) critical splice donor site probably null
IGL01946:Cerkl APN 2 79,223,364 (GRCm39) missense probably benign 0.19
IGL02027:Cerkl APN 2 79,171,630 (GRCm39) unclassified probably benign
IGL02809:Cerkl APN 2 79,172,546 (GRCm39) missense possibly damaging 0.54
IGL03293:Cerkl APN 2 79,172,719 (GRCm39) missense probably damaging 0.98
R0076:Cerkl UTSW 2 79,173,633 (GRCm39) missense possibly damaging 0.93
R0453:Cerkl UTSW 2 79,172,795 (GRCm39) missense probably benign 0.25
R0918:Cerkl UTSW 2 79,163,973 (GRCm39) missense probably benign 0.00
R1533:Cerkl UTSW 2 79,171,701 (GRCm39) missense possibly damaging 0.94
R4003:Cerkl UTSW 2 79,259,138 (GRCm39) missense possibly damaging 0.86
R5078:Cerkl UTSW 2 79,223,352 (GRCm39) missense probably benign 0.29
R5093:Cerkl UTSW 2 79,163,867 (GRCm39) missense probably damaging 1.00
R5431:Cerkl UTSW 2 79,171,679 (GRCm39) missense probably damaging 1.00
R5522:Cerkl UTSW 2 79,223,328 (GRCm39) missense probably benign 0.44
R6249:Cerkl UTSW 2 79,199,122 (GRCm39) missense probably damaging 1.00
R7036:Cerkl UTSW 2 79,171,722 (GRCm39) missense probably benign 0.03
R7201:Cerkl UTSW 2 79,163,934 (GRCm39) missense probably benign 0.00
R7326:Cerkl UTSW 2 79,162,949 (GRCm39) missense probably benign 0.37
R7343:Cerkl UTSW 2 79,259,104 (GRCm39) missense probably damaging 1.00
R7874:Cerkl UTSW 2 79,168,981 (GRCm39) missense probably damaging 1.00
R8190:Cerkl UTSW 2 79,163,901 (GRCm39) missense probably benign 0.17
R8333:Cerkl UTSW 2 79,168,922 (GRCm39) missense possibly damaging 0.65
R8470:Cerkl UTSW 2 79,172,751 (GRCm39) missense probably benign 0.08
R9223:Cerkl UTSW 2 79,171,674 (GRCm39) missense probably damaging 0.99
R9659:Cerkl UTSW 2 79,223,322 (GRCm39) missense possibly damaging 0.51
Z1176:Cerkl UTSW 2 79,199,109 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGTCTGAGAACATATCTTTAACAAGTT -3'
(R):5'- ATGCAATTATGGGTTGTGTAGTCTC -3'

Sequencing Primer
(F):5'- TCAGGTGTAAAGCCTCTG -3'
(R):5'- GATCAGATGTCAGCTTTGCATATG -3'
Posted On 2019-12-20