Incidental Mutation 'R7833:Cerkl'
ID605756
Institutional Source Beutler Lab
Gene Symbol Cerkl
Ensembl Gene ENSMUSG00000075256
Gene Nameceramide kinase-like
SynonymsRp26
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R7833 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location79330543-79456785 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79341380 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 378 (T378I)
Ref Sequence ENSEMBL: ENSMUSP00000114325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143974] [ENSMUST00000156731]
Predicted Effect probably benign
Transcript: ENSMUST00000143974
AA Change: T378I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000114325
Gene: ENSMUSG00000075256
AA Change: T378I

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 70 80 N/A INTRINSIC
Pfam:DAGK_cat 152 293 2.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156731
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was initially identified as a locus (RP26) associated with an autosomal recessive form of retinitis pigmentosa (arRP) disease. This gene encodes a protein with ceramide kinase-like domains, however, the protein does not phosphorylate ceramide and its target substrate is currently unknown. This protein may be a negative regulator of apoptosis in photoreceptor cells. Mutations in this gene cause a form of retinitis pigmentosa characterized by autosomal recessive cone and rod dystrophy (arCRD). Alternative splicing of this gene results in multiple transcript variants encoding different isoforms and non-coding transcripts.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit retinal apoptosis and decreased amplitudes and increased implicit time of oscillatory potentials. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,312,278 S84G probably benign Het
Acin1 A T 14: 54,664,602 S578T possibly damaging Het
Acot5 A G 12: 84,075,827 Q395R probably damaging Het
Adamts15 T A 9: 30,922,105 T45S probably benign Het
Agbl2 A G 2: 90,815,433 K837E probably benign Het
Atf2 T C 2: 73,853,885 T19A possibly damaging Het
Atp6v0a2 T C 5: 124,645,031 V238A probably damaging Het
Atp9a A T 2: 168,674,857 V430E probably benign Het
Cachd1 G A 4: 100,974,815 V725I probably benign Het
Ccnb1 G A 13: 100,781,351 T247M probably damaging Het
Cd40 A T 2: 165,066,511 D169V probably benign Het
Cdc25c G A 18: 34,747,243 T146I probably benign Het
Ceacam3 C A 7: 17,159,853 Q430K Het
Cpn2 G T 16: 30,260,345 N179K probably damaging Het
Duox1 A G 2: 122,324,388 D418G probably damaging Het
Eps8l1 C A 7: 4,468,867 P11T possibly damaging Het
Erc1 C T 6: 119,824,486 W190* probably null Het
Exosc7 A T 9: 123,130,919 E195V probably benign Het
F2rl2 A G 13: 95,700,918 N157S probably damaging Het
Fgd2 T C 17: 29,367,395 L270P possibly damaging Het
Fitm2 A T 2: 163,470,099 W65R probably damaging Het
Gabbr1 T G 17: 37,056,969 I437S possibly damaging Het
Galntl6 A T 8: 57,857,537 S377T probably benign Het
Gm17727 T A 9: 35,777,110 S60C probably damaging Het
Gm21936 G A 12: 87,795,552 R14K unknown Het
Gm281 A T 14: 13,896,968 probably null Het
Gm340 A G 19: 41,584,585 D593G probably benign Het
Gml2 T A 15: 74,821,368 C73* probably null Het
Htr6 G T 4: 139,061,831 F304L probably damaging Het
Hydin G A 8: 110,589,460 G4328D probably damaging Het
Kcnj14 T C 7: 45,817,893 D343G probably damaging Het
Klhdc1 T A 12: 69,283,168 I357N probably benign Het
Man2a1 A G 17: 64,666,751 T341A probably damaging Het
Mrm1 A C 11: 84,818,643 V196G probably damaging Het
Mybbp1a A G 11: 72,442,901 probably null Het
Myo19 G A 11: 84,909,267 C826Y probably benign Het
Nbea A G 3: 56,002,797 W1326R probably damaging Het
Notch1 A G 2: 26,459,533 *2532Q probably null Het
Npas2 A G 1: 39,326,147 Y287C probably damaging Het
Olfr1016 T A 2: 85,799,949 D107V probably benign Het
Olfr401 G A 11: 74,121,837 D183N probably damaging Het
Pcdhga7 C A 18: 37,716,024 D361E possibly damaging Het
Pde10a T A 17: 8,961,920 Y447N possibly damaging Het
Piwil2 T A 14: 70,395,441 I561F probably benign Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ppp4r4 A G 12: 103,598,148 T591A probably benign Het
Ptprb A G 10: 116,315,251 T273A probably benign Het
Ptpro T A 6: 137,416,863 L843* probably null Het
Qrfpr T C 3: 36,189,602 I117V probably benign Het
Qrich2 T C 11: 116,455,765 D1411G probably benign Het
Rad51ap2 T C 12: 11,456,655 S193P probably benign Het
Raver1 T C 9: 21,081,314 E273G probably benign Het
Rubcn C A 16: 32,868,274 probably benign Het
S1pr4 C T 10: 81,498,492 V383I possibly damaging Het
Scn7a T C 2: 66,676,150 D1465G probably damaging Het
Smarca4 T A 9: 21,647,359 D607E possibly damaging Het
Srbd1 T A 17: 85,985,454 I896L possibly damaging Het
Sulf2 G T 2: 166,079,536 N722K possibly damaging Het
Surf1 A G 2: 26,916,268 Y22H probably benign Het
Syngr2 A G 11: 117,813,156 T150A probably benign Het
Szt2 G T 4: 118,366,219 H3056N unknown Het
Tmf1 A T 6: 97,161,411 S849T probably benign Het
Tns1 T A 1: 74,091,331 probably benign Het
Trio G T 15: 27,774,086 P1764Q probably damaging Het
Trpc3 A T 3: 36,640,672 V711D probably damaging Het
Ttll3 G T 6: 113,409,337 K710N probably damaging Het
Unc13c A G 9: 73,481,109 S2132P possibly damaging Het
Utp20 G A 10: 88,801,136 P738S possibly damaging Het
Vmn2r76 C T 7: 86,228,684 V502I probably benign Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdr64 T G 1: 175,763,945 F390V probably damaging Het
Ybx3 T G 6: 131,367,863 T341P possibly damaging Het
Zdhhc11 C A 13: 73,973,747 Q126K possibly damaging Het
Zfp777 G A 6: 48,025,138 P673S probably damaging Het
Other mutations in Cerkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Cerkl APN 2 79341499 missense probably benign 0.00
IGL01330:Cerkl APN 2 79368781 missense possibly damaging 0.90
IGL01468:Cerkl APN 2 79343215 critical splice donor site probably null
IGL01946:Cerkl APN 2 79393020 missense probably benign 0.19
IGL02027:Cerkl APN 2 79341286 unclassified probably benign
IGL02809:Cerkl APN 2 79342202 missense possibly damaging 0.54
IGL03293:Cerkl APN 2 79342375 missense probably damaging 0.98
R0076:Cerkl UTSW 2 79343289 missense possibly damaging 0.93
R0453:Cerkl UTSW 2 79342451 missense probably benign 0.25
R0918:Cerkl UTSW 2 79333629 missense probably benign 0.00
R1533:Cerkl UTSW 2 79341357 missense possibly damaging 0.94
R4003:Cerkl UTSW 2 79428794 missense possibly damaging 0.86
R5078:Cerkl UTSW 2 79393008 missense probably benign 0.29
R5093:Cerkl UTSW 2 79333523 missense probably damaging 1.00
R5431:Cerkl UTSW 2 79341335 missense probably damaging 1.00
R5522:Cerkl UTSW 2 79392984 missense probably benign 0.44
R6249:Cerkl UTSW 2 79368778 missense probably damaging 1.00
R7036:Cerkl UTSW 2 79341378 missense probably benign 0.03
R7201:Cerkl UTSW 2 79333590 missense probably benign 0.00
R7326:Cerkl UTSW 2 79332605 missense probably benign 0.37
R7343:Cerkl UTSW 2 79428760 missense probably damaging 1.00
R7874:Cerkl UTSW 2 79338637 missense probably damaging 1.00
R8190:Cerkl UTSW 2 79333557 missense probably benign 0.17
R8333:Cerkl UTSW 2 79338578 missense possibly damaging 0.65
Z1176:Cerkl UTSW 2 79368765 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGTCTGAGAACATATCTTTAACAAGTT -3'
(R):5'- ATGCAATTATGGGTTGTGTAGTCTC -3'

Sequencing Primer
(F):5'- TCAGGTGTAAAGCCTCTG -3'
(R):5'- GATCAGATGTCAGCTTTGCATATG -3'
Posted On2019-12-20