Mutagenetix > Incidental Mutation

Incidental Mutation 'R7833:Duox1'

605759

Institutional Source

Beutler Lab

Gene Symbol

Duox1

Ensembl Gene

ENSMUSG00000033268

Gene Name

dual oxidase 1

Synonyms

THOX1, LNOX1, 9930101G15Rik, NOXEF1

MMRRC Submission

Accession Numbers

Genbank: NM_001099297; MGI: 2139422

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7833 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

122315672-122347972 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122324388 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 418 (D418G)

Ref Sequence

ENSEMBL: ENSMUSP00000097060 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099461]

AlphaFold

A2AQ92

Predicted Effect

probably damaging
Transcript: ENSMUST00000099461
AA Change: D418G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097060
Gene: ENSMUSG00000033268
AA Change: D418G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:An_peroxidase	29	557	2.1e-134	PFAM
transmembrane domain	594	616	N/A	INTRINSIC
EFh	819	847	1.82e-4	SMART
EFh	855	883	3.45e-5	SMART
transmembrane domain	1044	1066	N/A	INTRINSIC
Pfam:Ferric_reduct	1087	1236	5.3e-21	PFAM
Pfam:FAD_binding_8	1272	1374	8.5e-21	PFAM
Pfam:NAD_binding_6	1380	1534	3.5e-33	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes proteins encoded by this gene and the similar DUOX2 gene. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. This protein generates hydrogen peroxide and thereby plays a role in the activity of thyroid peroxidase, lactoperoxidase, and in lactoperoxidase-mediated antimicrobial defense at mucosal surfaces. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2012]

Allele List at MGI

All alleles(6) : Targeted, other(3) Gene trapped(3)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	T	C	13: 64,312,278	S84G	probably benign	Het
Acin1	A	T	14: 54,664,602	S578T	possibly damaging	Het
Acot5	A	G	12: 84,075,827	Q395R	probably damaging	Het
Adamts15	T	A	9: 30,922,105	T45S	probably benign	Het
Agbl2	A	G	2: 90,815,433	K837E	probably benign	Het
Atf2	T	C	2: 73,853,885	T19A	possibly damaging	Het
Atp6v0a2	T	C	5: 124,645,031	V238A	probably damaging	Het
Atp9a	A	T	2: 168,674,857	V430E	probably benign	Het
Cachd1	G	A	4: 100,974,815	V725I	probably benign	Het
Ccnb1	G	A	13: 100,781,351	T247M	probably damaging	Het
Cd40	A	T	2: 165,066,511	D169V	probably benign	Het
Cdc25c	G	A	18: 34,747,243	T146I	probably benign	Het
Ceacam3	C	A	7: 17,159,853	Q430K		Het
Cerkl	G	A	2: 79,341,380	T378I	probably benign	Het
Cpn2	G	T	16: 30,260,345	N179K	probably damaging	Het
Eps8l1	C	A	7: 4,468,867	P11T	possibly damaging	Het
Erc1	C	T	6: 119,824,486	W190*	probably null	Het
Exosc7	A	T	9: 123,130,919	E195V	probably benign	Het
F2rl2	A	G	13: 95,700,918	N157S	probably damaging	Het
Fgd2	T	C	17: 29,367,395	L270P	possibly damaging	Het
Fitm2	A	T	2: 163,470,099	W65R	probably damaging	Het
Gabbr1	T	G	17: 37,056,969	I437S	possibly damaging	Het
Galntl6	A	T	8: 57,857,537	S377T	probably benign	Het
Gm17727	T	A	9: 35,777,110	S60C	probably damaging	Het
Gm21936	G	A	12: 87,795,552	R14K	unknown	Het
Gm281	A	T	14: 13,896,968		probably null	Het
Gm340	A	G	19: 41,584,585	D593G	probably benign	Het
Gml2	T	A	15: 74,821,368	C73*	probably null	Het
Htr6	G	T	4: 139,061,831	F304L	probably damaging	Het
Hydin	G	A	8: 110,589,460	G4328D	probably damaging	Het
Kcnj14	T	C	7: 45,817,893	D343G	probably damaging	Het
Klhdc1	T	A	12: 69,283,168	I357N	probably benign	Het
Man2a1	A	G	17: 64,666,751	T341A	probably damaging	Het
Mrm1	A	C	11: 84,818,643	V196G	probably damaging	Het
Mybbp1a	A	G	11: 72,442,901		probably null	Het
Myo19	G	A	11: 84,909,267	C826Y	probably benign	Het
Nbea	A	G	3: 56,002,797	W1326R	probably damaging	Het
Notch1	A	G	2: 26,459,533	*2532Q	probably null	Het
Npas2	A	G	1: 39,326,147	Y287C	probably damaging	Het
Olfr1016	T	A	2: 85,799,949	D107V	probably benign	Het
Olfr401	G	A	11: 74,121,837	D183N	probably damaging	Het
Pcdhga7	C	A	18: 37,716,024	D361E	possibly damaging	Het
Pde10a	T	A	17: 8,961,920	Y447N	possibly damaging	Het
Piwil2	T	A	14: 70,395,441	I561F	probably benign	Het
Pml	C	A	9: 58,234,685	R288L	probably benign	Het
Ppp4r4	A	G	12: 103,598,148	T591A	probably benign	Het
Ptprb	A	G	10: 116,315,251	T273A	probably benign	Het
Ptpro	T	A	6: 137,416,863	L843*	probably null	Het
Qrfpr	T	C	3: 36,189,602	I117V	probably benign	Het
Qrich2	T	C	11: 116,455,765	D1411G	probably benign	Het
Rad51ap2	T	C	12: 11,456,655	S193P	probably benign	Het
Raver1	T	C	9: 21,081,314	E273G	probably benign	Het
Rubcn	C	A	16: 32,868,274		probably benign	Het
S1pr4	C	T	10: 81,498,492	V383I	possibly damaging	Het
Scn7a	T	C	2: 66,676,150	D1465G	probably damaging	Het
Smarca4	T	A	9: 21,647,359	D607E	possibly damaging	Het
Srbd1	T	A	17: 85,985,454	I896L	possibly damaging	Het
Sulf2	G	T	2: 166,079,536	N722K	possibly damaging	Het
Surf1	A	G	2: 26,916,268	Y22H	probably benign	Het
Syngr2	A	G	11: 117,813,156	T150A	probably benign	Het
Szt2	G	T	4: 118,366,219	H3056N	unknown	Het
Tmf1	A	T	6: 97,161,411	S849T	probably benign	Het
Tns1	T	A	1: 74,091,331		probably benign	Het
Trio	G	T	15: 27,774,086	P1764Q	probably damaging	Het
Trpc3	A	T	3: 36,640,672	V711D	probably damaging	Het
Ttll3	G	T	6: 113,409,337	K710N	probably damaging	Het
Unc13c	A	G	9: 73,481,109	S2132P	possibly damaging	Het
Utp20	G	A	10: 88,801,136	P738S	possibly damaging	Het
Vmn2r76	C	T	7: 86,228,684	V502I	probably benign	Het
Vsig1	C	T	X: 140,933,126	H232Y	probably benign	Het
Wdr64	T	G	1: 175,763,945	F390V	probably damaging	Het
Ybx3	T	G	6: 131,367,863	T341P	possibly damaging	Het
Zdhhc11	C	A	13: 73,973,747	Q126K	possibly damaging	Het
Zfp777	G	A	6: 48,025,138	P673S	probably damaging	Het

Other mutations in Duox1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00650:Duox1	APN	2	122333141	missense	possibly damaging	0.55
IGL00956:Duox1	APN	2	122323306	missense	probably benign	0.42
IGL01413:Duox1	APN	2	122320710	missense	probably benign	0.03
IGL01444:Duox1	APN	2	122340090	missense	probably damaging	0.98
IGL01633:Duox1	APN	2	122333798	missense	probably benign	0.00
IGL01814:Duox1	APN	2	122346272	missense	probably damaging	0.99
IGL01868:Duox1	APN	2	122338407	missense	probably benign
IGL02096:Duox1	APN	2	122344174	missense	probably damaging	0.99
IGL02126:Duox1	APN	2	122346336	missense	probably benign	0.21
IGL02342:Duox1	APN	2	122347312	missense	probably damaging	1.00
IGL02687:Duox1	APN	2	122336415	missense	probably damaging	1.00
IGL02708:Duox1	APN	2	122326017	missense	possibly damaging	0.81
IGL02935:Duox1	APN	2	122324519	missense	possibly damaging	0.56
antiquity	UTSW	2	122340201	missense	probably damaging	1.00
Dejavous	UTSW	2	122320864	missense	probably damaging	1.00
R1706_Duox1_051	UTSW	2	122319472	missense	probably benign	0.01
R5032_duox1_732	UTSW	2	122337317	missense	probably benign
Vaguely	UTSW	2	122326135	nonsense	probably null
D4043:Duox1	UTSW	2	122344795	missense	probably benign
R0047:Duox1	UTSW	2	122346641	unclassified	probably benign
R0047:Duox1	UTSW	2	122346641	unclassified	probably benign
R0241:Duox1	UTSW	2	122333397	splice site	probably benign
R0479:Duox1	UTSW	2	122346380	missense	probably damaging	1.00
R0834:Duox1	UTSW	2	122346501	missense	probably damaging	1.00
R1105:Duox1	UTSW	2	122337702	missense	probably damaging	0.97
R1205:Duox1	UTSW	2	122327925	nonsense	probably null
R1281:Duox1	UTSW	2	122327088	missense	probably damaging	1.00
R1302:Duox1	UTSW	2	122347279	missense	probably benign	0.24
R1532:Duox1	UTSW	2	122344723	missense	probably damaging	1.00
R1706:Duox1	UTSW	2	122319472	missense	probably benign	0.01
R1719:Duox1	UTSW	2	122338644	missense	possibly damaging	0.93
R1753:Duox1	UTSW	2	122333429	missense	probably damaging	1.00
R1827:Duox1	UTSW	2	122347380	nonsense	probably null
R1828:Duox1	UTSW	2	122347380	nonsense	probably null
R1940:Duox1	UTSW	2	122325984	missense	probably benign	0.06
R1944:Duox1	UTSW	2	122346520	missense	probably damaging	0.99
R2069:Duox1	UTSW	2	122333062	missense	probably benign
R2113:Duox1	UTSW	2	122337254	missense	probably benign
R2202:Duox1	UTSW	2	122344713	missense	probably benign	0.19
R2314:Duox1	UTSW	2	122333730	nonsense	probably null
R2507:Duox1	UTSW	2	122333138	missense	probably benign	0.34
R2508:Duox1	UTSW	2	122333138	missense	probably benign	0.34
R3177:Duox1	UTSW	2	122340116	missense	probably damaging	1.00
R3277:Duox1	UTSW	2	122340116	missense	probably damaging	1.00
R4124:Duox1	UTSW	2	122337421	missense	probably damaging	1.00
R4271:Duox1	UTSW	2	122324375	missense	probably damaging	0.96
R4411:Duox1	UTSW	2	122337634	missense	probably benign	0.30
R4419:Duox1	UTSW	2	122327126	missense	probably benign
R4420:Duox1	UTSW	2	122327126	missense	probably benign
R4578:Duox1	UTSW	2	122333777	missense	probably benign	0.15
R4628:Duox1	UTSW	2	122346252	missense	probably damaging	1.00
R4665:Duox1	UTSW	2	122319475	missense	probably benign	0.00
R4666:Duox1	UTSW	2	122319475	missense	probably benign	0.00
R4730:Duox1	UTSW	2	122333831	missense	probably damaging	1.00
R4767:Duox1	UTSW	2	122333441	missense	possibly damaging	0.79
R4857:Duox1	UTSW	2	122315731	missense	probably benign	0.05
R4904:Duox1	UTSW	2	122320864	missense	probably damaging	1.00
R5032:Duox1	UTSW	2	122337317	missense	probably benign
R5201:Duox1	UTSW	2	122327922	missense	probably benign
R5474:Duox1	UTSW	2	122346625	missense	probably benign	0.02
R5835:Duox1	UTSW	2	122327860	missense	probably benign	0.00
R5939:Duox1	UTSW	2	122346351	missense	probably damaging	1.00
R5941:Duox1	UTSW	2	122344156	missense	probably damaging	0.97
R5943:Duox1	UTSW	2	122333435	missense	probably benign	0.00
R5970:Duox1	UTSW	2	122340201	missense	probably damaging	1.00
R6023:Duox1	UTSW	2	122337684	missense	probably benign	0.19
R6050:Duox1	UTSW	2	122319475	missense	probably benign	0.00
R6064:Duox1	UTSW	2	122320762	missense	probably benign	0.00
R6093:Duox1	UTSW	2	122347274	missense	probably benign	0.01
R6188:Duox1	UTSW	2	122319794	missense	probably benign	0.00
R6246:Duox1	UTSW	2	122327174	missense	probably damaging	1.00
R6259:Duox1	UTSW	2	122344783	missense	probably benign	0.00
R6290:Duox1	UTSW	2	122333807	missense	possibly damaging	0.92
R6300:Duox1	UTSW	2	122337700	missense	probably damaging	0.99
R6341:Duox1	UTSW	2	122337721	missense	probably damaging	0.98
R6498:Duox1	UTSW	2	122319607	missense	probably damaging	1.00
R6883:Duox1	UTSW	2	122324584	splice site	probably null
R7002:Duox1	UTSW	2	122319877	nonsense	probably null
R7410:Duox1	UTSW	2	122346393	missense	probably damaging	1.00
R7421:Duox1	UTSW	2	122323230	missense	probably damaging	1.00
R7608:Duox1	UTSW	2	122326135	nonsense	probably null
R7702:Duox1	UTSW	2	122329639	missense	possibly damaging	0.86
R7766:Duox1	UTSW	2	122337301	missense	probably benign
R7980:Duox1	UTSW	2	122347320	missense	possibly damaging	0.71
R8275:Duox1	UTSW	2	122344768	missense	probably benign	0.02
R8717:Duox1	UTSW	2	122337671	missense	possibly damaging	0.88
R8992:Duox1	UTSW	2	122344705	missense	probably damaging	1.00
R9196:Duox1	UTSW	2	122320208	missense	probably benign	0.08
R9344:Duox1	UTSW	2	122337682	missense	probably benign	0.14
R9397:Duox1	UTSW	2	122320302	missense	possibly damaging	0.48
R9491:Duox1	UTSW	2	122326426	missense	probably benign	0.01
R9510:Duox1	UTSW	2	122329542	missense	possibly damaging	0.92
R9521:Duox1	UTSW	2	122328735	missense	possibly damaging	0.81
R9562:Duox1	UTSW	2	122320722	missense	probably damaging	1.00
R9565:Duox1	UTSW	2	122320722	missense	probably damaging	1.00
R9569:Duox1	UTSW	2	122318490	missense	probably benign
Z1176:Duox1	UTSW	2	122333038	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGGAGATCCTGCTGAACCTG -3'
(R):5'- TGTTAGACTCTGGCACCCATG -3'

Sequencing Primer
(F):5'- TGCTGAACCTGCAGAAGC -3'
(R):5'- AGACTCTGGCACCCATGTTTTAC -3'

Posted On

2019-12-20