Incidental Mutation 'R7833:Duox1'
ID 605759
Institutional Source Beutler Lab
Gene Symbol Duox1
Ensembl Gene ENSMUSG00000033268
Gene Name dual oxidase 1
Synonyms NOXEF1, LNOX1, 9930101G15Rik, THOX1
MMRRC Submission 045887-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7833 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 122146153-122178453 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 122154869 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 418 (D418G)
Ref Sequence ENSEMBL: ENSMUSP00000097060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099461]
AlphaFold A2AQ92
Predicted Effect probably damaging
Transcript: ENSMUST00000099461
AA Change: D418G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097060
Gene: ENSMUSG00000033268
AA Change: D418G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:An_peroxidase 29 557 2.1e-134 PFAM
transmembrane domain 594 616 N/A INTRINSIC
EFh 819 847 1.82e-4 SMART
EFh 855 883 3.45e-5 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Ferric_reduct 1087 1236 5.3e-21 PFAM
Pfam:FAD_binding_8 1272 1374 8.5e-21 PFAM
Pfam:NAD_binding_6 1380 1534 3.5e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes proteins encoded by this gene and the similar DUOX2 gene. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. This protein generates hydrogen peroxide and thereby plays a role in the activity of thyroid peroxidase, lactoperoxidase, and in lactoperoxidase-mediated antimicrobial defense at mucosal surfaces. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI

All alleles(6) : Targeted, other(3) Gene trapped(3)

 

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,902,059 (GRCm39) S578T possibly damaging Het
Acot5 A G 12: 84,122,601 (GRCm39) Q395R probably damaging Het
Adamts15 T A 9: 30,833,401 (GRCm39) T45S probably benign Het
Agbl2 A G 2: 90,645,777 (GRCm39) K837E probably benign Het
Atf2 T C 2: 73,684,229 (GRCm39) T19A possibly damaging Het
Atp6v0a2 T C 5: 124,782,969 (GRCm39) V238A probably damaging Het
Atp9a A T 2: 168,516,777 (GRCm39) V430E probably benign Het
Cachd1 G A 4: 100,832,012 (GRCm39) V725I probably benign Het
Ccnb1 G A 13: 100,917,859 (GRCm39) T247M probably damaging Het
Cd40 A T 2: 164,908,431 (GRCm39) D169V probably benign Het
Cdc25c G A 18: 34,880,296 (GRCm39) T146I probably benign Het
Cdhr18 A T 14: 13,896,968 (GRCm38) probably null Het
Ceacam3 C A 7: 16,893,778 (GRCm39) Q430K Het
Cerkl G A 2: 79,171,724 (GRCm39) T378I probably benign Het
Cpn2 G T 16: 30,079,163 (GRCm39) N179K probably damaging Het
Eif1ad13 G A 12: 87,762,322 (GRCm39) R14K unknown Het
Eps8l1 C A 7: 4,471,866 (GRCm39) P11T possibly damaging Het
Erc1 C T 6: 119,801,447 (GRCm39) W190* probably null Het
Exosc7 A T 9: 122,959,984 (GRCm39) E195V probably benign Het
F2rl2 A G 13: 95,837,426 (GRCm39) N157S probably damaging Het
Fgd2 T C 17: 29,586,369 (GRCm39) L270P possibly damaging Het
Fitm2 A T 2: 163,312,019 (GRCm39) W65R probably damaging Het
Gabbr1 T G 17: 37,367,861 (GRCm39) I437S possibly damaging Het
Galntl6 A T 8: 58,310,571 (GRCm39) S377T probably benign Het
Gml2 T A 15: 74,693,217 (GRCm39) C73* probably null Het
Htr6 G T 4: 138,789,142 (GRCm39) F304L probably damaging Het
Hydin G A 8: 111,316,092 (GRCm39) G4328D probably damaging Het
Kcnj14 T C 7: 45,467,317 (GRCm39) D343G probably damaging Het
Klhdc1 T A 12: 69,329,942 (GRCm39) I357N probably benign Het
Lcor A G 19: 41,573,024 (GRCm39) D593G probably benign Het
Man2a1 A G 17: 64,973,746 (GRCm39) T341A probably damaging Het
Mrm1 A C 11: 84,709,469 (GRCm39) V196G probably damaging Het
Mybbp1a A G 11: 72,333,727 (GRCm39) probably null Het
Myo19 G A 11: 84,800,093 (GRCm39) C826Y probably benign Het
Nbea A G 3: 55,910,218 (GRCm39) W1326R probably damaging Het
Notch1 A G 2: 26,349,545 (GRCm39) *2532Q probably null Het
Npas2 A G 1: 39,365,228 (GRCm39) Y287C probably damaging Het
Or3a1b G A 11: 74,012,663 (GRCm39) D183N probably damaging Het
Or9g20 T A 2: 85,630,293 (GRCm39) D107V probably benign Het
Pate7 T A 9: 35,688,406 (GRCm39) S60C probably damaging Het
Pcdhga7 C A 18: 37,849,077 (GRCm39) D361E possibly damaging Het
Pde10a T A 17: 9,180,752 (GRCm39) Y447N possibly damaging Het
Piwil2 T A 14: 70,632,890 (GRCm39) I561F probably benign Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Ppp4r4 A G 12: 103,564,407 (GRCm39) T591A probably benign Het
Prxl2c T C 13: 64,460,092 (GRCm39) S84G probably benign Het
Ptprb A G 10: 116,151,156 (GRCm39) T273A probably benign Het
Ptpro T A 6: 137,393,861 (GRCm39) L843* probably null Het
Qrfpr T C 3: 36,243,751 (GRCm39) I117V probably benign Het
Qrich2 T C 11: 116,346,591 (GRCm39) D1411G probably benign Het
Rad51ap2 T C 12: 11,506,656 (GRCm39) S193P probably benign Het
Raver1 T C 9: 20,992,610 (GRCm39) E273G probably benign Het
Rubcn C A 16: 32,688,644 (GRCm39) probably benign Het
S1pr4 C T 10: 81,334,326 (GRCm39) V383I possibly damaging Het
Scn7a T C 2: 66,506,494 (GRCm39) D1465G probably damaging Het
Smarca4 T A 9: 21,558,655 (GRCm39) D607E possibly damaging Het
Srbd1 T A 17: 86,292,882 (GRCm39) I896L possibly damaging Het
Sulf2 G T 2: 165,921,456 (GRCm39) N722K possibly damaging Het
Surf1 A G 2: 26,806,280 (GRCm39) Y22H probably benign Het
Syngr2 A G 11: 117,703,982 (GRCm39) T150A probably benign Het
Szt2 G T 4: 118,223,416 (GRCm39) H3056N unknown Het
Tmf1 A T 6: 97,138,372 (GRCm39) S849T probably benign Het
Tns1 T A 1: 74,130,490 (GRCm39) probably benign Het
Trio G T 15: 27,774,172 (GRCm39) P1764Q probably damaging Het
Trpc3 A T 3: 36,694,821 (GRCm39) V711D probably damaging Het
Ttll3 G T 6: 113,386,298 (GRCm39) K710N probably damaging Het
Unc13c A G 9: 73,388,391 (GRCm39) S2132P possibly damaging Het
Utp20 G A 10: 88,636,998 (GRCm39) P738S possibly damaging Het
Vmn2r76 C T 7: 85,877,892 (GRCm39) V502I probably benign Het
Vsig1 C T X: 139,833,875 (GRCm39) H232Y probably benign Het
Wdr64 T G 1: 175,591,511 (GRCm39) F390V probably damaging Het
Ybx3 T G 6: 131,344,826 (GRCm39) T341P possibly damaging Het
Zdhhc11 C A 13: 74,121,866 (GRCm39) Q126K possibly damaging Het
Zfp777 G A 6: 48,002,072 (GRCm39) P673S probably damaging Het
Other mutations in Duox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Duox1 APN 2 122,163,622 (GRCm39) missense possibly damaging 0.55
IGL00956:Duox1 APN 2 122,153,787 (GRCm39) missense probably benign 0.42
IGL01413:Duox1 APN 2 122,151,191 (GRCm39) missense probably benign 0.03
IGL01444:Duox1 APN 2 122,170,571 (GRCm39) missense probably damaging 0.98
IGL01633:Duox1 APN 2 122,164,279 (GRCm39) missense probably benign 0.00
IGL01814:Duox1 APN 2 122,176,753 (GRCm39) missense probably damaging 0.99
IGL01868:Duox1 APN 2 122,168,888 (GRCm39) missense probably benign
IGL02096:Duox1 APN 2 122,174,655 (GRCm39) missense probably damaging 0.99
IGL02126:Duox1 APN 2 122,176,817 (GRCm39) missense probably benign 0.21
IGL02342:Duox1 APN 2 122,177,793 (GRCm39) missense probably damaging 1.00
IGL02687:Duox1 APN 2 122,166,896 (GRCm39) missense probably damaging 1.00
IGL02708:Duox1 APN 2 122,156,498 (GRCm39) missense possibly damaging 0.81
IGL02935:Duox1 APN 2 122,155,000 (GRCm39) missense possibly damaging 0.56
antiquity UTSW 2 122,170,682 (GRCm39) missense probably damaging 1.00
Dejavous UTSW 2 122,151,345 (GRCm39) missense probably damaging 1.00
R1706_Duox1_051 UTSW 2 122,149,953 (GRCm39) missense probably benign 0.01
R5032_duox1_732 UTSW 2 122,167,798 (GRCm39) missense probably benign
Vaguely UTSW 2 122,156,616 (GRCm39) nonsense probably null
D4043:Duox1 UTSW 2 122,175,276 (GRCm39) missense probably benign
R0047:Duox1 UTSW 2 122,177,122 (GRCm39) unclassified probably benign
R0047:Duox1 UTSW 2 122,177,122 (GRCm39) unclassified probably benign
R0241:Duox1 UTSW 2 122,163,878 (GRCm39) splice site probably benign
R0479:Duox1 UTSW 2 122,176,861 (GRCm39) missense probably damaging 1.00
R0834:Duox1 UTSW 2 122,176,982 (GRCm39) missense probably damaging 1.00
R1105:Duox1 UTSW 2 122,168,183 (GRCm39) missense probably damaging 0.97
R1205:Duox1 UTSW 2 122,158,406 (GRCm39) nonsense probably null
R1281:Duox1 UTSW 2 122,157,569 (GRCm39) missense probably damaging 1.00
R1302:Duox1 UTSW 2 122,177,760 (GRCm39) missense probably benign 0.24
R1532:Duox1 UTSW 2 122,175,204 (GRCm39) missense probably damaging 1.00
R1706:Duox1 UTSW 2 122,149,953 (GRCm39) missense probably benign 0.01
R1719:Duox1 UTSW 2 122,169,125 (GRCm39) missense possibly damaging 0.93
R1753:Duox1 UTSW 2 122,163,910 (GRCm39) missense probably damaging 1.00
R1827:Duox1 UTSW 2 122,177,861 (GRCm39) nonsense probably null
R1828:Duox1 UTSW 2 122,177,861 (GRCm39) nonsense probably null
R1940:Duox1 UTSW 2 122,156,465 (GRCm39) missense probably benign 0.06
R1944:Duox1 UTSW 2 122,177,001 (GRCm39) missense probably damaging 0.99
R2069:Duox1 UTSW 2 122,163,543 (GRCm39) missense probably benign
R2113:Duox1 UTSW 2 122,167,735 (GRCm39) missense probably benign
R2202:Duox1 UTSW 2 122,175,194 (GRCm39) missense probably benign 0.19
R2314:Duox1 UTSW 2 122,164,211 (GRCm39) nonsense probably null
R2507:Duox1 UTSW 2 122,163,619 (GRCm39) missense probably benign 0.34
R2508:Duox1 UTSW 2 122,163,619 (GRCm39) missense probably benign 0.34
R3177:Duox1 UTSW 2 122,170,597 (GRCm39) missense probably damaging 1.00
R3277:Duox1 UTSW 2 122,170,597 (GRCm39) missense probably damaging 1.00
R4124:Duox1 UTSW 2 122,167,902 (GRCm39) missense probably damaging 1.00
R4271:Duox1 UTSW 2 122,154,856 (GRCm39) missense probably damaging 0.96
R4411:Duox1 UTSW 2 122,168,115 (GRCm39) missense probably benign 0.30
R4419:Duox1 UTSW 2 122,157,607 (GRCm39) missense probably benign
R4420:Duox1 UTSW 2 122,157,607 (GRCm39) missense probably benign
R4578:Duox1 UTSW 2 122,164,258 (GRCm39) missense probably benign 0.15
R4628:Duox1 UTSW 2 122,176,733 (GRCm39) missense probably damaging 1.00
R4665:Duox1 UTSW 2 122,149,956 (GRCm39) missense probably benign 0.00
R4666:Duox1 UTSW 2 122,149,956 (GRCm39) missense probably benign 0.00
R4730:Duox1 UTSW 2 122,164,312 (GRCm39) missense probably damaging 1.00
R4767:Duox1 UTSW 2 122,163,922 (GRCm39) missense possibly damaging 0.79
R4857:Duox1 UTSW 2 122,146,212 (GRCm39) missense probably benign 0.05
R4904:Duox1 UTSW 2 122,151,345 (GRCm39) missense probably damaging 1.00
R5032:Duox1 UTSW 2 122,167,798 (GRCm39) missense probably benign
R5201:Duox1 UTSW 2 122,158,403 (GRCm39) missense probably benign
R5474:Duox1 UTSW 2 122,177,106 (GRCm39) missense probably benign 0.02
R5835:Duox1 UTSW 2 122,158,341 (GRCm39) missense probably benign 0.00
R5939:Duox1 UTSW 2 122,176,832 (GRCm39) missense probably damaging 1.00
R5941:Duox1 UTSW 2 122,174,637 (GRCm39) missense probably damaging 0.97
R5943:Duox1 UTSW 2 122,163,916 (GRCm39) missense probably benign 0.00
R5970:Duox1 UTSW 2 122,170,682 (GRCm39) missense probably damaging 1.00
R6023:Duox1 UTSW 2 122,168,165 (GRCm39) missense probably benign 0.19
R6050:Duox1 UTSW 2 122,149,956 (GRCm39) missense probably benign 0.00
R6064:Duox1 UTSW 2 122,151,243 (GRCm39) missense probably benign 0.00
R6093:Duox1 UTSW 2 122,177,755 (GRCm39) missense probably benign 0.01
R6188:Duox1 UTSW 2 122,150,275 (GRCm39) missense probably benign 0.00
R6246:Duox1 UTSW 2 122,157,655 (GRCm39) missense probably damaging 1.00
R6259:Duox1 UTSW 2 122,175,264 (GRCm39) missense probably benign 0.00
R6290:Duox1 UTSW 2 122,164,288 (GRCm39) missense possibly damaging 0.92
R6300:Duox1 UTSW 2 122,168,181 (GRCm39) missense probably damaging 0.99
R6341:Duox1 UTSW 2 122,168,202 (GRCm39) missense probably damaging 0.98
R6498:Duox1 UTSW 2 122,150,088 (GRCm39) missense probably damaging 1.00
R6883:Duox1 UTSW 2 122,155,065 (GRCm39) splice site probably null
R7002:Duox1 UTSW 2 122,150,358 (GRCm39) nonsense probably null
R7410:Duox1 UTSW 2 122,176,874 (GRCm39) missense probably damaging 1.00
R7421:Duox1 UTSW 2 122,153,711 (GRCm39) missense probably damaging 1.00
R7608:Duox1 UTSW 2 122,156,616 (GRCm39) nonsense probably null
R7702:Duox1 UTSW 2 122,160,120 (GRCm39) missense possibly damaging 0.86
R7766:Duox1 UTSW 2 122,167,782 (GRCm39) missense probably benign
R7980:Duox1 UTSW 2 122,177,801 (GRCm39) missense possibly damaging 0.71
R8275:Duox1 UTSW 2 122,175,249 (GRCm39) missense probably benign 0.02
R8717:Duox1 UTSW 2 122,168,152 (GRCm39) missense possibly damaging 0.88
R8992:Duox1 UTSW 2 122,175,186 (GRCm39) missense probably damaging 1.00
R9196:Duox1 UTSW 2 122,150,689 (GRCm39) missense probably benign 0.08
R9344:Duox1 UTSW 2 122,168,163 (GRCm39) missense probably benign 0.14
R9397:Duox1 UTSW 2 122,150,783 (GRCm39) missense possibly damaging 0.48
R9491:Duox1 UTSW 2 122,156,907 (GRCm39) missense probably benign 0.01
R9510:Duox1 UTSW 2 122,160,023 (GRCm39) missense possibly damaging 0.92
R9521:Duox1 UTSW 2 122,159,216 (GRCm39) missense possibly damaging 0.81
R9562:Duox1 UTSW 2 122,151,203 (GRCm39) missense probably damaging 1.00
R9565:Duox1 UTSW 2 122,151,203 (GRCm39) missense probably damaging 1.00
R9569:Duox1 UTSW 2 122,148,971 (GRCm39) missense probably benign
Z1176:Duox1 UTSW 2 122,163,519 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGAGATCCTGCTGAACCTG -3'
(R):5'- TGTTAGACTCTGGCACCCATG -3'

Sequencing Primer
(F):5'- TGCTGAACCTGCAGAAGC -3'
(R):5'- AGACTCTGGCACCCATGTTTTAC -3'
Posted On 2019-12-20