Incidental Mutation 'R7833:Duox1'
ID605759
Institutional Source Beutler Lab
Gene Symbol Duox1
Ensembl Gene ENSMUSG00000033268
Gene Namedual oxidase 1
SynonymsTHOX1, LNOX1, 9930101G15Rik, NOXEF1
MMRRC Submission
Accession Numbers

Genbank: NM_001099297; MGI: 2139422

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7833 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location122315672-122347972 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122324388 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 418 (D418G)
Ref Sequence ENSEMBL: ENSMUSP00000097060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099461]
Predicted Effect probably damaging
Transcript: ENSMUST00000099461
AA Change: D418G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097060
Gene: ENSMUSG00000033268
AA Change: D418G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:An_peroxidase 29 557 2.1e-134 PFAM
transmembrane domain 594 616 N/A INTRINSIC
EFh 819 847 1.82e-4 SMART
EFh 855 883 3.45e-5 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Ferric_reduct 1087 1236 5.3e-21 PFAM
Pfam:FAD_binding_8 1272 1374 8.5e-21 PFAM
Pfam:NAD_binding_6 1380 1534 3.5e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes proteins encoded by this gene and the similar DUOX2 gene. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. This protein generates hydrogen peroxide and thereby plays a role in the activity of thyroid peroxidase, lactoperoxidase, and in lactoperoxidase-mediated antimicrobial defense at mucosal surfaces. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI

All alleles(6) : Targeted, other(3) Gene trapped(3)

 

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,312,278 S84G probably benign Het
Acin1 A T 14: 54,664,602 S578T possibly damaging Het
Acot5 A G 12: 84,075,827 Q395R probably damaging Het
Adamts15 T A 9: 30,922,105 T45S probably benign Het
Agbl2 A G 2: 90,815,433 K837E probably benign Het
Atf2 T C 2: 73,853,885 T19A possibly damaging Het
Atp6v0a2 T C 5: 124,645,031 V238A probably damaging Het
Atp9a A T 2: 168,674,857 V430E probably benign Het
Cachd1 G A 4: 100,974,815 V725I probably benign Het
Ccnb1 G A 13: 100,781,351 T247M probably damaging Het
Cd40 A T 2: 165,066,511 D169V probably benign Het
Cdc25c G A 18: 34,747,243 T146I probably benign Het
Ceacam3 C A 7: 17,159,853 Q430K Het
Cerkl G A 2: 79,341,380 T378I probably benign Het
Cpn2 G T 16: 30,260,345 N179K probably damaging Het
Eps8l1 C A 7: 4,468,867 P11T possibly damaging Het
Erc1 C T 6: 119,824,486 W190* probably null Het
Exosc7 A T 9: 123,130,919 E195V probably benign Het
F2rl2 A G 13: 95,700,918 N157S probably damaging Het
Fgd2 T C 17: 29,367,395 L270P possibly damaging Het
Fitm2 A T 2: 163,470,099 W65R probably damaging Het
Gabbr1 T G 17: 37,056,969 I437S possibly damaging Het
Galntl6 A T 8: 57,857,537 S377T probably benign Het
Gm17727 T A 9: 35,777,110 S60C probably damaging Het
Gm21936 G A 12: 87,795,552 R14K unknown Het
Gm281 A T 14: 13,896,968 probably null Het
Gm340 A G 19: 41,584,585 D593G probably benign Het
Gml2 T A 15: 74,821,368 C73* probably null Het
Htr6 G T 4: 139,061,831 F304L probably damaging Het
Hydin G A 8: 110,589,460 G4328D probably damaging Het
Kcnj14 T C 7: 45,817,893 D343G probably damaging Het
Klhdc1 T A 12: 69,283,168 I357N probably benign Het
Man2a1 A G 17: 64,666,751 T341A probably damaging Het
Mrm1 A C 11: 84,818,643 V196G probably damaging Het
Mybbp1a A G 11: 72,442,901 probably null Het
Myo19 G A 11: 84,909,267 C826Y probably benign Het
Nbea A G 3: 56,002,797 W1326R probably damaging Het
Notch1 A G 2: 26,459,533 *2532Q probably null Het
Npas2 A G 1: 39,326,147 Y287C probably damaging Het
Olfr1016 T A 2: 85,799,949 D107V probably benign Het
Olfr401 G A 11: 74,121,837 D183N probably damaging Het
Pcdhga7 C A 18: 37,716,024 D361E possibly damaging Het
Pde10a T A 17: 8,961,920 Y447N possibly damaging Het
Piwil2 T A 14: 70,395,441 I561F probably benign Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ppp4r4 A G 12: 103,598,148 T591A probably benign Het
Ptprb A G 10: 116,315,251 T273A probably benign Het
Ptpro T A 6: 137,416,863 L843* probably null Het
Qrfpr T C 3: 36,189,602 I117V probably benign Het
Qrich2 T C 11: 116,455,765 D1411G probably benign Het
Rad51ap2 T C 12: 11,456,655 S193P probably benign Het
Raver1 T C 9: 21,081,314 E273G probably benign Het
Rubcn C A 16: 32,868,274 probably benign Het
S1pr4 C T 10: 81,498,492 V383I possibly damaging Het
Scn7a T C 2: 66,676,150 D1465G probably damaging Het
Smarca4 T A 9: 21,647,359 D607E possibly damaging Het
Srbd1 T A 17: 85,985,454 I896L possibly damaging Het
Sulf2 G T 2: 166,079,536 N722K possibly damaging Het
Surf1 A G 2: 26,916,268 Y22H probably benign Het
Syngr2 A G 11: 117,813,156 T150A probably benign Het
Szt2 G T 4: 118,366,219 H3056N unknown Het
Tmf1 A T 6: 97,161,411 S849T probably benign Het
Tns1 T A 1: 74,091,331 probably benign Het
Trio G T 15: 27,774,086 P1764Q probably damaging Het
Trpc3 A T 3: 36,640,672 V711D probably damaging Het
Ttll3 G T 6: 113,409,337 K710N probably damaging Het
Unc13c A G 9: 73,481,109 S2132P possibly damaging Het
Utp20 G A 10: 88,801,136 P738S possibly damaging Het
Vmn2r76 C T 7: 86,228,684 V502I probably benign Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdr64 T G 1: 175,763,945 F390V probably damaging Het
Ybx3 T G 6: 131,367,863 T341P possibly damaging Het
Zdhhc11 C A 13: 73,973,747 Q126K possibly damaging Het
Zfp777 G A 6: 48,025,138 P673S probably damaging Het
Other mutations in Duox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Duox1 APN 2 122333141 missense possibly damaging 0.55
IGL00956:Duox1 APN 2 122323306 missense probably benign 0.42
IGL01413:Duox1 APN 2 122320710 missense probably benign 0.03
IGL01444:Duox1 APN 2 122340090 missense probably damaging 0.98
IGL01633:Duox1 APN 2 122333798 missense probably benign 0.00
IGL01814:Duox1 APN 2 122346272 missense probably damaging 0.99
IGL01868:Duox1 APN 2 122338407 missense probably benign
IGL02096:Duox1 APN 2 122344174 missense probably damaging 0.99
IGL02126:Duox1 APN 2 122346336 missense probably benign 0.21
IGL02342:Duox1 APN 2 122347312 missense probably damaging 1.00
IGL02687:Duox1 APN 2 122336415 missense probably damaging 1.00
IGL02708:Duox1 APN 2 122326017 missense possibly damaging 0.81
IGL02935:Duox1 APN 2 122324519 missense possibly damaging 0.56
Vaguely UTSW 2 122326135 nonsense probably null
D4043:Duox1 UTSW 2 122344795 missense probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0241:Duox1 UTSW 2 122333397 splice site probably benign
R0479:Duox1 UTSW 2 122346380 missense probably damaging 1.00
R0834:Duox1 UTSW 2 122346501 missense probably damaging 1.00
R1105:Duox1 UTSW 2 122337702 missense probably damaging 0.97
R1205:Duox1 UTSW 2 122327925 nonsense probably null
R1281:Duox1 UTSW 2 122327088 missense probably damaging 1.00
R1302:Duox1 UTSW 2 122347279 missense probably benign 0.24
R1532:Duox1 UTSW 2 122344723 missense probably damaging 1.00
R1706:Duox1 UTSW 2 122319472 missense probably benign 0.01
R1719:Duox1 UTSW 2 122338644 missense possibly damaging 0.93
R1753:Duox1 UTSW 2 122333429 missense probably damaging 1.00
R1827:Duox1 UTSW 2 122347380 nonsense probably null
R1828:Duox1 UTSW 2 122347380 nonsense probably null
R1940:Duox1 UTSW 2 122325984 missense probably benign 0.06
R1944:Duox1 UTSW 2 122346520 missense probably damaging 0.99
R2069:Duox1 UTSW 2 122333062 missense probably benign
R2113:Duox1 UTSW 2 122337254 missense probably benign
R2202:Duox1 UTSW 2 122344713 missense probably benign 0.19
R2314:Duox1 UTSW 2 122333730 nonsense probably null
R2507:Duox1 UTSW 2 122333138 missense probably benign 0.34
R2508:Duox1 UTSW 2 122333138 missense probably benign 0.34
R3177:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R3277:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R4124:Duox1 UTSW 2 122337421 missense probably damaging 1.00
R4271:Duox1 UTSW 2 122324375 missense probably damaging 0.96
R4411:Duox1 UTSW 2 122337634 missense probably benign 0.30
R4419:Duox1 UTSW 2 122327126 missense probably benign
R4420:Duox1 UTSW 2 122327126 missense probably benign
R4578:Duox1 UTSW 2 122333777 missense probably benign 0.15
R4628:Duox1 UTSW 2 122346252 missense probably damaging 1.00
R4665:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4666:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4730:Duox1 UTSW 2 122333831 missense probably damaging 1.00
R4767:Duox1 UTSW 2 122333441 missense possibly damaging 0.79
R4857:Duox1 UTSW 2 122315731 missense probably benign 0.05
R4904:Duox1 UTSW 2 122320864 missense probably damaging 1.00
R5032:Duox1 UTSW 2 122337317 missense probably benign
R5201:Duox1 UTSW 2 122327922 missense probably benign
R5474:Duox1 UTSW 2 122346625 missense probably benign 0.02
R5835:Duox1 UTSW 2 122327860 missense probably benign 0.00
R5939:Duox1 UTSW 2 122346351 missense probably damaging 1.00
R5941:Duox1 UTSW 2 122344156 missense probably damaging 0.97
R5943:Duox1 UTSW 2 122333435 missense probably benign 0.00
R5970:Duox1 UTSW 2 122340201 missense probably damaging 1.00
R6023:Duox1 UTSW 2 122337684 missense probably benign 0.19
R6050:Duox1 UTSW 2 122319475 missense probably benign 0.00
R6064:Duox1 UTSW 2 122320762 missense probably benign 0.00
R6093:Duox1 UTSW 2 122347274 missense probably benign 0.01
R6188:Duox1 UTSW 2 122319794 missense probably benign 0.00
R6246:Duox1 UTSW 2 122327174 missense probably damaging 1.00
R6259:Duox1 UTSW 2 122344783 missense probably benign 0.00
R6290:Duox1 UTSW 2 122333807 missense possibly damaging 0.92
R6300:Duox1 UTSW 2 122337700 missense probably damaging 0.99
R6341:Duox1 UTSW 2 122337721 missense probably damaging 0.98
R6498:Duox1 UTSW 2 122319607 missense probably damaging 1.00
R6883:Duox1 UTSW 2 122324584 splice site probably null
R7002:Duox1 UTSW 2 122319877 nonsense probably null
R7410:Duox1 UTSW 2 122346393 missense probably damaging 1.00
R7421:Duox1 UTSW 2 122323230 missense probably damaging 1.00
R7608:Duox1 UTSW 2 122326135 nonsense probably null
R7702:Duox1 UTSW 2 122329639 missense possibly damaging 0.86
R7766:Duox1 UTSW 2 122337301 missense probably benign
R7980:Duox1 UTSW 2 122347320 missense possibly damaging 0.71
R8275:Duox1 UTSW 2 122344768 missense probably benign 0.02
Z1176:Duox1 UTSW 2 122333038 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGAGATCCTGCTGAACCTG -3'
(R):5'- TGTTAGACTCTGGCACCCATG -3'

Sequencing Primer
(F):5'- TGCTGAACCTGCAGAAGC -3'
(R):5'- AGACTCTGGCACCCATGTTTTAC -3'
Posted On2019-12-20