Incidental Mutation 'R7833:Sulf2'
ID 605762
Institutional Source Beutler Lab
Gene Symbol Sulf2
Ensembl Gene ENSMUSG00000006800
Gene Name sulfatase 2
Synonyms 2010004N24Rik
MMRRC Submission 045887-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.261) question?
Stock # R7833 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 165915819-165997603 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 165921456 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 722 (N722K)
Ref Sequence ENSEMBL: ENSMUSP00000085405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088086] [ENSMUST00000109249] [ENSMUST00000146497]
AlphaFold Q8CFG0
Predicted Effect possibly damaging
Transcript: ENSMUST00000088086
AA Change: N722K

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000085405
Gene: ENSMUSG00000006800
AA Change: N722K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sulfatase 44 375 2.8e-50 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 669 5.6e-47 PFAM
low complexity region 702 720 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109249
AA Change: N722K

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104872
Gene: ENSMUSG00000006800
AA Change: N722K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sulfatase 44 375 2.8e-50 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 532 670 1.3e-46 PFAM
low complexity region 702 720 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146497
AA Change: N722K

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate proteoglycans (HSPGs) act as coreceptors for numerous heparin-binding growth factors and cytokines and are involved in cell signaling. Heparan sulfate 6-O-endosulfatases, such as SULF2, selectively remove 6-O-sulfate groups from heparan sulfate. This activity modulates the effects of heparan sulfate by altering binding sites for signaling molecules (Dai et al., 2005 [PubMed 16192265]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous disruption of this gene may lead to a partially penetrant, strain-dependent phenotype of embryonic lethality, reduced postnatal body weight, lung abnormalities, brain malformations, and reduced fertility. Mice homozygous for a hypomorphic gene-trap allele display skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,902,059 (GRCm39) S578T possibly damaging Het
Acot5 A G 12: 84,122,601 (GRCm39) Q395R probably damaging Het
Adamts15 T A 9: 30,833,401 (GRCm39) T45S probably benign Het
Agbl2 A G 2: 90,645,777 (GRCm39) K837E probably benign Het
Atf2 T C 2: 73,684,229 (GRCm39) T19A possibly damaging Het
Atp6v0a2 T C 5: 124,782,969 (GRCm39) V238A probably damaging Het
Atp9a A T 2: 168,516,777 (GRCm39) V430E probably benign Het
Cachd1 G A 4: 100,832,012 (GRCm39) V725I probably benign Het
Ccnb1 G A 13: 100,917,859 (GRCm39) T247M probably damaging Het
Cd40 A T 2: 164,908,431 (GRCm39) D169V probably benign Het
Cdc25c G A 18: 34,880,296 (GRCm39) T146I probably benign Het
Cdhr18 A T 14: 13,896,968 (GRCm38) probably null Het
Ceacam3 C A 7: 16,893,778 (GRCm39) Q430K Het
Cerkl G A 2: 79,171,724 (GRCm39) T378I probably benign Het
Cpn2 G T 16: 30,079,163 (GRCm39) N179K probably damaging Het
Duox1 A G 2: 122,154,869 (GRCm39) D418G probably damaging Het
Eif1ad13 G A 12: 87,762,322 (GRCm39) R14K unknown Het
Eps8l1 C A 7: 4,471,866 (GRCm39) P11T possibly damaging Het
Erc1 C T 6: 119,801,447 (GRCm39) W190* probably null Het
Exosc7 A T 9: 122,959,984 (GRCm39) E195V probably benign Het
F2rl2 A G 13: 95,837,426 (GRCm39) N157S probably damaging Het
Fgd2 T C 17: 29,586,369 (GRCm39) L270P possibly damaging Het
Fitm2 A T 2: 163,312,019 (GRCm39) W65R probably damaging Het
Gabbr1 T G 17: 37,367,861 (GRCm39) I437S possibly damaging Het
Galntl6 A T 8: 58,310,571 (GRCm39) S377T probably benign Het
Gml2 T A 15: 74,693,217 (GRCm39) C73* probably null Het
Htr6 G T 4: 138,789,142 (GRCm39) F304L probably damaging Het
Hydin G A 8: 111,316,092 (GRCm39) G4328D probably damaging Het
Kcnj14 T C 7: 45,467,317 (GRCm39) D343G probably damaging Het
Klhdc1 T A 12: 69,329,942 (GRCm39) I357N probably benign Het
Lcor A G 19: 41,573,024 (GRCm39) D593G probably benign Het
Man2a1 A G 17: 64,973,746 (GRCm39) T341A probably damaging Het
Mrm1 A C 11: 84,709,469 (GRCm39) V196G probably damaging Het
Mybbp1a A G 11: 72,333,727 (GRCm39) probably null Het
Myo19 G A 11: 84,800,093 (GRCm39) C826Y probably benign Het
Nbea A G 3: 55,910,218 (GRCm39) W1326R probably damaging Het
Notch1 A G 2: 26,349,545 (GRCm39) *2532Q probably null Het
Npas2 A G 1: 39,365,228 (GRCm39) Y287C probably damaging Het
Or3a1b G A 11: 74,012,663 (GRCm39) D183N probably damaging Het
Or9g20 T A 2: 85,630,293 (GRCm39) D107V probably benign Het
Pate7 T A 9: 35,688,406 (GRCm39) S60C probably damaging Het
Pcdhga7 C A 18: 37,849,077 (GRCm39) D361E possibly damaging Het
Pde10a T A 17: 9,180,752 (GRCm39) Y447N possibly damaging Het
Piwil2 T A 14: 70,632,890 (GRCm39) I561F probably benign Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Ppp4r4 A G 12: 103,564,407 (GRCm39) T591A probably benign Het
Prxl2c T C 13: 64,460,092 (GRCm39) S84G probably benign Het
Ptprb A G 10: 116,151,156 (GRCm39) T273A probably benign Het
Ptpro T A 6: 137,393,861 (GRCm39) L843* probably null Het
Qrfpr T C 3: 36,243,751 (GRCm39) I117V probably benign Het
Qrich2 T C 11: 116,346,591 (GRCm39) D1411G probably benign Het
Rad51ap2 T C 12: 11,506,656 (GRCm39) S193P probably benign Het
Raver1 T C 9: 20,992,610 (GRCm39) E273G probably benign Het
Rubcn C A 16: 32,688,644 (GRCm39) probably benign Het
S1pr4 C T 10: 81,334,326 (GRCm39) V383I possibly damaging Het
Scn7a T C 2: 66,506,494 (GRCm39) D1465G probably damaging Het
Smarca4 T A 9: 21,558,655 (GRCm39) D607E possibly damaging Het
Srbd1 T A 17: 86,292,882 (GRCm39) I896L possibly damaging Het
Surf1 A G 2: 26,806,280 (GRCm39) Y22H probably benign Het
Syngr2 A G 11: 117,703,982 (GRCm39) T150A probably benign Het
Szt2 G T 4: 118,223,416 (GRCm39) H3056N unknown Het
Tmf1 A T 6: 97,138,372 (GRCm39) S849T probably benign Het
Tns1 T A 1: 74,130,490 (GRCm39) probably benign Het
Trio G T 15: 27,774,172 (GRCm39) P1764Q probably damaging Het
Trpc3 A T 3: 36,694,821 (GRCm39) V711D probably damaging Het
Ttll3 G T 6: 113,386,298 (GRCm39) K710N probably damaging Het
Unc13c A G 9: 73,388,391 (GRCm39) S2132P possibly damaging Het
Utp20 G A 10: 88,636,998 (GRCm39) P738S possibly damaging Het
Vmn2r76 C T 7: 85,877,892 (GRCm39) V502I probably benign Het
Vsig1 C T X: 139,833,875 (GRCm39) H232Y probably benign Het
Wdr64 T G 1: 175,591,511 (GRCm39) F390V probably damaging Het
Ybx3 T G 6: 131,344,826 (GRCm39) T341P possibly damaging Het
Zdhhc11 C A 13: 74,121,866 (GRCm39) Q126K possibly damaging Het
Zfp777 G A 6: 48,002,072 (GRCm39) P673S probably damaging Het
Other mutations in Sulf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Sulf2 APN 2 165,936,412 (GRCm39) missense possibly damaging 0.48
IGL01353:Sulf2 APN 2 165,929,015 (GRCm39) missense probably damaging 1.00
IGL02427:Sulf2 APN 2 165,931,218 (GRCm39) missense probably damaging 0.99
IGL02602:Sulf2 APN 2 165,923,220 (GRCm39) missense probably benign 0.32
IGL02681:Sulf2 APN 2 165,958,905 (GRCm39) missense probably benign 0.01
IGL03047:Sulf2 APN 2 165,922,814 (GRCm39) splice site probably null
PIT4468001:Sulf2 UTSW 2 165,922,720 (GRCm39) missense probably benign
R0029:Sulf2 UTSW 2 165,958,893 (GRCm39) missense possibly damaging 0.46
R0029:Sulf2 UTSW 2 165,958,893 (GRCm39) missense possibly damaging 0.46
R0233:Sulf2 UTSW 2 165,927,589 (GRCm39) splice site probably benign
R0332:Sulf2 UTSW 2 165,931,119 (GRCm39) missense probably benign 0.00
R0411:Sulf2 UTSW 2 165,935,436 (GRCm39) missense probably damaging 1.00
R0599:Sulf2 UTSW 2 165,925,799 (GRCm39) missense possibly damaging 0.53
R0694:Sulf2 UTSW 2 165,927,711 (GRCm39) missense probably damaging 1.00
R1594:Sulf2 UTSW 2 165,926,367 (GRCm39) splice site probably benign
R1710:Sulf2 UTSW 2 165,920,992 (GRCm39) missense probably benign
R1725:Sulf2 UTSW 2 165,923,281 (GRCm39) missense probably damaging 0.96
R1737:Sulf2 UTSW 2 165,924,598 (GRCm39) missense probably benign 0.01
R1775:Sulf2 UTSW 2 165,921,532 (GRCm39) missense probably benign 0.07
R2001:Sulf2 UTSW 2 165,922,773 (GRCm39) missense probably benign 0.05
R2570:Sulf2 UTSW 2 165,927,721 (GRCm39) missense probably benign 0.21
R4052:Sulf2 UTSW 2 165,936,510 (GRCm39) missense probably damaging 1.00
R4357:Sulf2 UTSW 2 165,919,497 (GRCm39) missense probably benign 0.01
R4613:Sulf2 UTSW 2 165,974,525 (GRCm39) missense probably damaging 1.00
R4790:Sulf2 UTSW 2 165,931,215 (GRCm39) missense probably damaging 1.00
R4858:Sulf2 UTSW 2 165,923,524 (GRCm39) missense probably benign 0.00
R5033:Sulf2 UTSW 2 165,923,542 (GRCm39) missense probably benign 0.01
R5692:Sulf2 UTSW 2 165,923,426 (GRCm39) missense probably benign 0.03
R5695:Sulf2 UTSW 2 165,974,678 (GRCm39) missense probably benign 0.03
R6504:Sulf2 UTSW 2 165,925,841 (GRCm39) missense probably benign 0.00
R6816:Sulf2 UTSW 2 165,924,674 (GRCm39) missense probably benign
R6859:Sulf2 UTSW 2 165,929,039 (GRCm39) missense probably damaging 1.00
R6873:Sulf2 UTSW 2 165,931,195 (GRCm39) missense probably damaging 0.97
R7125:Sulf2 UTSW 2 165,917,448 (GRCm39) nonsense probably null
R7329:Sulf2 UTSW 2 165,959,008 (GRCm39) missense probably damaging 1.00
R7343:Sulf2 UTSW 2 165,919,536 (GRCm39) missense possibly damaging 0.69
R7669:Sulf2 UTSW 2 165,935,516 (GRCm39) missense possibly damaging 0.67
R8421:Sulf2 UTSW 2 165,958,972 (GRCm39) missense probably benign 0.11
R8430:Sulf2 UTSW 2 165,916,736 (GRCm39) missense probably benign 0.03
R8861:Sulf2 UTSW 2 165,974,606 (GRCm39) missense possibly damaging 0.96
R9285:Sulf2 UTSW 2 165,935,435 (GRCm39) missense probably damaging 1.00
R9410:Sulf2 UTSW 2 165,936,444 (GRCm39) missense
RF016:Sulf2 UTSW 2 165,924,523 (GRCm39) missense probably benign 0.01
X0063:Sulf2 UTSW 2 165,921,053 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGGTAGGTGGCCATGCAC -3'
(R):5'- CTTAGAGCCCTTGATGACGCTG -3'

Sequencing Primer
(F):5'- ATGCACAGGCCTCCCATTC -3'
(R):5'- TTGATGACGCTGCCCAAC -3'
Posted On 2019-12-20