Incidental Mutation 'R7833:Qrfpr'
ID 605764
Institutional Source Beutler Lab
Gene Symbol Qrfpr
Ensembl Gene ENSMUSG00000058400
Gene Name pyroglutamylated RFamide peptide receptor
Synonyms AQ27, Gpr103
MMRRC Submission 045887-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7833 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 36233575-36276462 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36243751 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 117 (I117V)
Ref Sequence ENSEMBL: ENSMUSP00000088768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091227] [ENSMUST00000197447]
AlphaFold P83861
Predicted Effect probably benign
Transcript: ENSMUST00000091227
AA Change: I117V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088768
Gene: ENSMUSG00000058400
AA Change: I117V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 56 347 3.6e-8 PFAM
Pfam:7tm_1 62 332 4.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197447
AA Change: I117V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143773
Gene: ENSMUSG00000058400
AA Change: I117V

DomainStartEndE-ValueType
low complexity region 40 61 N/A INTRINSIC
Pfam:7tm_1 62 229 1.1e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Mice homozygous for a mutation diisplay kyphosis with abnormal vertebrae morphology and development including osteopenia of the vertebrae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,902,059 (GRCm39) S578T possibly damaging Het
Acot5 A G 12: 84,122,601 (GRCm39) Q395R probably damaging Het
Adamts15 T A 9: 30,833,401 (GRCm39) T45S probably benign Het
Agbl2 A G 2: 90,645,777 (GRCm39) K837E probably benign Het
Atf2 T C 2: 73,684,229 (GRCm39) T19A possibly damaging Het
Atp6v0a2 T C 5: 124,782,969 (GRCm39) V238A probably damaging Het
Atp9a A T 2: 168,516,777 (GRCm39) V430E probably benign Het
Cachd1 G A 4: 100,832,012 (GRCm39) V725I probably benign Het
Ccnb1 G A 13: 100,917,859 (GRCm39) T247M probably damaging Het
Cd40 A T 2: 164,908,431 (GRCm39) D169V probably benign Het
Cdc25c G A 18: 34,880,296 (GRCm39) T146I probably benign Het
Cdhr18 A T 14: 13,896,968 (GRCm38) probably null Het
Ceacam3 C A 7: 16,893,778 (GRCm39) Q430K Het
Cerkl G A 2: 79,171,724 (GRCm39) T378I probably benign Het
Cpn2 G T 16: 30,079,163 (GRCm39) N179K probably damaging Het
Duox1 A G 2: 122,154,869 (GRCm39) D418G probably damaging Het
Eif1ad13 G A 12: 87,762,322 (GRCm39) R14K unknown Het
Eps8l1 C A 7: 4,471,866 (GRCm39) P11T possibly damaging Het
Erc1 C T 6: 119,801,447 (GRCm39) W190* probably null Het
Exosc7 A T 9: 122,959,984 (GRCm39) E195V probably benign Het
F2rl2 A G 13: 95,837,426 (GRCm39) N157S probably damaging Het
Fgd2 T C 17: 29,586,369 (GRCm39) L270P possibly damaging Het
Fitm2 A T 2: 163,312,019 (GRCm39) W65R probably damaging Het
Gabbr1 T G 17: 37,367,861 (GRCm39) I437S possibly damaging Het
Galntl6 A T 8: 58,310,571 (GRCm39) S377T probably benign Het
Gml2 T A 15: 74,693,217 (GRCm39) C73* probably null Het
Htr6 G T 4: 138,789,142 (GRCm39) F304L probably damaging Het
Hydin G A 8: 111,316,092 (GRCm39) G4328D probably damaging Het
Kcnj14 T C 7: 45,467,317 (GRCm39) D343G probably damaging Het
Klhdc1 T A 12: 69,329,942 (GRCm39) I357N probably benign Het
Lcor A G 19: 41,573,024 (GRCm39) D593G probably benign Het
Man2a1 A G 17: 64,973,746 (GRCm39) T341A probably damaging Het
Mrm1 A C 11: 84,709,469 (GRCm39) V196G probably damaging Het
Mybbp1a A G 11: 72,333,727 (GRCm39) probably null Het
Myo19 G A 11: 84,800,093 (GRCm39) C826Y probably benign Het
Nbea A G 3: 55,910,218 (GRCm39) W1326R probably damaging Het
Notch1 A G 2: 26,349,545 (GRCm39) *2532Q probably null Het
Npas2 A G 1: 39,365,228 (GRCm39) Y287C probably damaging Het
Or3a1b G A 11: 74,012,663 (GRCm39) D183N probably damaging Het
Or9g20 T A 2: 85,630,293 (GRCm39) D107V probably benign Het
Pate7 T A 9: 35,688,406 (GRCm39) S60C probably damaging Het
Pcdhga7 C A 18: 37,849,077 (GRCm39) D361E possibly damaging Het
Pde10a T A 17: 9,180,752 (GRCm39) Y447N possibly damaging Het
Piwil2 T A 14: 70,632,890 (GRCm39) I561F probably benign Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Ppp4r4 A G 12: 103,564,407 (GRCm39) T591A probably benign Het
Prxl2c T C 13: 64,460,092 (GRCm39) S84G probably benign Het
Ptprb A G 10: 116,151,156 (GRCm39) T273A probably benign Het
Ptpro T A 6: 137,393,861 (GRCm39) L843* probably null Het
Qrich2 T C 11: 116,346,591 (GRCm39) D1411G probably benign Het
Rad51ap2 T C 12: 11,506,656 (GRCm39) S193P probably benign Het
Raver1 T C 9: 20,992,610 (GRCm39) E273G probably benign Het
Rubcn C A 16: 32,688,644 (GRCm39) probably benign Het
S1pr4 C T 10: 81,334,326 (GRCm39) V383I possibly damaging Het
Scn7a T C 2: 66,506,494 (GRCm39) D1465G probably damaging Het
Smarca4 T A 9: 21,558,655 (GRCm39) D607E possibly damaging Het
Srbd1 T A 17: 86,292,882 (GRCm39) I896L possibly damaging Het
Sulf2 G T 2: 165,921,456 (GRCm39) N722K possibly damaging Het
Surf1 A G 2: 26,806,280 (GRCm39) Y22H probably benign Het
Syngr2 A G 11: 117,703,982 (GRCm39) T150A probably benign Het
Szt2 G T 4: 118,223,416 (GRCm39) H3056N unknown Het
Tmf1 A T 6: 97,138,372 (GRCm39) S849T probably benign Het
Tns1 T A 1: 74,130,490 (GRCm39) probably benign Het
Trio G T 15: 27,774,172 (GRCm39) P1764Q probably damaging Het
Trpc3 A T 3: 36,694,821 (GRCm39) V711D probably damaging Het
Ttll3 G T 6: 113,386,298 (GRCm39) K710N probably damaging Het
Unc13c A G 9: 73,388,391 (GRCm39) S2132P possibly damaging Het
Utp20 G A 10: 88,636,998 (GRCm39) P738S possibly damaging Het
Vmn2r76 C T 7: 85,877,892 (GRCm39) V502I probably benign Het
Vsig1 C T X: 139,833,875 (GRCm39) H232Y probably benign Het
Wdr64 T G 1: 175,591,511 (GRCm39) F390V probably damaging Het
Ybx3 T G 6: 131,344,826 (GRCm39) T341P possibly damaging Het
Zdhhc11 C A 13: 74,121,866 (GRCm39) Q126K possibly damaging Het
Zfp777 G A 6: 48,002,072 (GRCm39) P673S probably damaging Het
Other mutations in Qrfpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Qrfpr APN 3 36,235,200 (GRCm39) splice site probably null
IGL02274:Qrfpr APN 3 36,276,285 (GRCm39) missense probably damaging 0.98
R0382:Qrfpr UTSW 3 36,235,118 (GRCm39) missense possibly damaging 0.73
R0398:Qrfpr UTSW 3 36,235,201 (GRCm39) splice site probably benign
R0631:Qrfpr UTSW 3 36,276,138 (GRCm39) missense probably damaging 1.00
R0690:Qrfpr UTSW 3 36,243,708 (GRCm39) missense probably damaging 1.00
R1222:Qrfpr UTSW 3 36,234,244 (GRCm39) missense probably damaging 1.00
R1413:Qrfpr UTSW 3 36,236,809 (GRCm39) missense possibly damaging 0.92
R1418:Qrfpr UTSW 3 36,234,244 (GRCm39) missense probably damaging 1.00
R1500:Qrfpr UTSW 3 36,236,729 (GRCm39) missense probably damaging 1.00
R2037:Qrfpr UTSW 3 36,236,806 (GRCm39) missense probably damaging 0.99
R3924:Qrfpr UTSW 3 36,276,072 (GRCm39) missense possibly damaging 0.71
R3925:Qrfpr UTSW 3 36,276,072 (GRCm39) missense possibly damaging 0.71
R3966:Qrfpr UTSW 3 36,235,149 (GRCm39) missense possibly damaging 0.73
R4298:Qrfpr UTSW 3 36,243,703 (GRCm39) missense probably damaging 1.00
R4751:Qrfpr UTSW 3 36,236,771 (GRCm39) missense possibly damaging 0.67
R4760:Qrfpr UTSW 3 36,276,073 (GRCm39) missense probably benign 0.34
R4989:Qrfpr UTSW 3 36,276,285 (GRCm39) missense probably damaging 0.98
R5548:Qrfpr UTSW 3 36,276,075 (GRCm39) missense possibly damaging 0.84
R5607:Qrfpr UTSW 3 36,235,114 (GRCm39) missense possibly damaging 0.55
R5608:Qrfpr UTSW 3 36,235,114 (GRCm39) missense possibly damaging 0.55
R6027:Qrfpr UTSW 3 36,276,187 (GRCm39) missense probably benign 0.44
R6115:Qrfpr UTSW 3 36,236,742 (GRCm39) missense possibly damaging 0.51
R6546:Qrfpr UTSW 3 36,234,414 (GRCm39) missense probably damaging 1.00
R6714:Qrfpr UTSW 3 36,234,405 (GRCm39) missense possibly damaging 0.81
R7080:Qrfpr UTSW 3 36,234,198 (GRCm39) missense probably benign 0.04
R8796:Qrfpr UTSW 3 36,234,345 (GRCm39) missense probably damaging 1.00
R9032:Qrfpr UTSW 3 36,276,099 (GRCm39) missense probably damaging 1.00
R9085:Qrfpr UTSW 3 36,276,099 (GRCm39) missense probably damaging 1.00
R9121:Qrfpr UTSW 3 36,235,156 (GRCm39) missense probably damaging 1.00
R9522:Qrfpr UTSW 3 36,236,676 (GRCm39) missense probably damaging 1.00
Z1176:Qrfpr UTSW 3 36,236,759 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCTTCCAAATTGTCAGTACCAG -3'
(R):5'- TGTTCAATGCCCCTGAGAGC -3'

Sequencing Primer
(F):5'- GTACCAGATATTTTTGTCGAGTGAC -3'
(R):5'- CCCCTGAGAGCATAAAACTAGTTGG -3'
Posted On 2019-12-20