Incidental Mutation 'R7833:Cachd1'
ID 605767
Institutional Source Beutler Lab
Gene Symbol Cachd1
Ensembl Gene ENSMUSG00000028532
Gene Name cache domain containing 1
Synonyms Vwcd1, 1190007F10Rik, B430218L07Rik
MMRRC Submission 045887-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.274) question?
Stock # R7833 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 100633870-100861741 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 100832012 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 725 (V725I)
Ref Sequence ENSEMBL: ENSMUSP00000030257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030257] [ENSMUST00000097955]
AlphaFold Q6PDJ1
Predicted Effect probably benign
Transcript: ENSMUST00000030257
AA Change: V725I

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000030257
Gene: ENSMUSG00000028532
AA Change: V725I

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Pfam:VWA_N 103 218 9.4e-22 PFAM
VWA 240 438 2.8e-1 SMART
Pfam:Cache_1 467 543 2.4e-12 PFAM
Pfam:Cache_1 786 871 1.5e-7 PFAM
low complexity region 981 996 N/A INTRINSIC
transmembrane domain 1109 1131 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1240 1246 N/A INTRINSIC
low complexity region 1260 1274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097955
AA Change: V725I

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000095568
Gene: ENSMUSG00000028532
AA Change: V725I

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Pfam:VWA_N 103 218 6.7e-32 PFAM
VWA 240 438 2.8e-1 SMART
Pfam:Cache_1 467 543 1.7e-12 PFAM
low complexity region 801 818 N/A INTRINSIC
low complexity region 981 996 N/A INTRINSIC
transmembrane domain 1109 1131 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,902,059 (GRCm39) S578T possibly damaging Het
Acot5 A G 12: 84,122,601 (GRCm39) Q395R probably damaging Het
Adamts15 T A 9: 30,833,401 (GRCm39) T45S probably benign Het
Agbl2 A G 2: 90,645,777 (GRCm39) K837E probably benign Het
Atf2 T C 2: 73,684,229 (GRCm39) T19A possibly damaging Het
Atp6v0a2 T C 5: 124,782,969 (GRCm39) V238A probably damaging Het
Atp9a A T 2: 168,516,777 (GRCm39) V430E probably benign Het
Ccnb1 G A 13: 100,917,859 (GRCm39) T247M probably damaging Het
Cd40 A T 2: 164,908,431 (GRCm39) D169V probably benign Het
Cdc25c G A 18: 34,880,296 (GRCm39) T146I probably benign Het
Cdhr18 A T 14: 13,896,968 (GRCm38) probably null Het
Ceacam3 C A 7: 16,893,778 (GRCm39) Q430K Het
Cerkl G A 2: 79,171,724 (GRCm39) T378I probably benign Het
Cpn2 G T 16: 30,079,163 (GRCm39) N179K probably damaging Het
Duox1 A G 2: 122,154,869 (GRCm39) D418G probably damaging Het
Eif1ad13 G A 12: 87,762,322 (GRCm39) R14K unknown Het
Eps8l1 C A 7: 4,471,866 (GRCm39) P11T possibly damaging Het
Erc1 C T 6: 119,801,447 (GRCm39) W190* probably null Het
Exosc7 A T 9: 122,959,984 (GRCm39) E195V probably benign Het
F2rl2 A G 13: 95,837,426 (GRCm39) N157S probably damaging Het
Fgd2 T C 17: 29,586,369 (GRCm39) L270P possibly damaging Het
Fitm2 A T 2: 163,312,019 (GRCm39) W65R probably damaging Het
Gabbr1 T G 17: 37,367,861 (GRCm39) I437S possibly damaging Het
Galntl6 A T 8: 58,310,571 (GRCm39) S377T probably benign Het
Gml2 T A 15: 74,693,217 (GRCm39) C73* probably null Het
Htr6 G T 4: 138,789,142 (GRCm39) F304L probably damaging Het
Hydin G A 8: 111,316,092 (GRCm39) G4328D probably damaging Het
Kcnj14 T C 7: 45,467,317 (GRCm39) D343G probably damaging Het
Klhdc1 T A 12: 69,329,942 (GRCm39) I357N probably benign Het
Lcor A G 19: 41,573,024 (GRCm39) D593G probably benign Het
Man2a1 A G 17: 64,973,746 (GRCm39) T341A probably damaging Het
Mrm1 A C 11: 84,709,469 (GRCm39) V196G probably damaging Het
Mybbp1a A G 11: 72,333,727 (GRCm39) probably null Het
Myo19 G A 11: 84,800,093 (GRCm39) C826Y probably benign Het
Nbea A G 3: 55,910,218 (GRCm39) W1326R probably damaging Het
Notch1 A G 2: 26,349,545 (GRCm39) *2532Q probably null Het
Npas2 A G 1: 39,365,228 (GRCm39) Y287C probably damaging Het
Or3a1b G A 11: 74,012,663 (GRCm39) D183N probably damaging Het
Or9g20 T A 2: 85,630,293 (GRCm39) D107V probably benign Het
Pate7 T A 9: 35,688,406 (GRCm39) S60C probably damaging Het
Pcdhga7 C A 18: 37,849,077 (GRCm39) D361E possibly damaging Het
Pde10a T A 17: 9,180,752 (GRCm39) Y447N possibly damaging Het
Piwil2 T A 14: 70,632,890 (GRCm39) I561F probably benign Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Ppp4r4 A G 12: 103,564,407 (GRCm39) T591A probably benign Het
Prxl2c T C 13: 64,460,092 (GRCm39) S84G probably benign Het
Ptprb A G 10: 116,151,156 (GRCm39) T273A probably benign Het
Ptpro T A 6: 137,393,861 (GRCm39) L843* probably null Het
Qrfpr T C 3: 36,243,751 (GRCm39) I117V probably benign Het
Qrich2 T C 11: 116,346,591 (GRCm39) D1411G probably benign Het
Rad51ap2 T C 12: 11,506,656 (GRCm39) S193P probably benign Het
Raver1 T C 9: 20,992,610 (GRCm39) E273G probably benign Het
Rubcn C A 16: 32,688,644 (GRCm39) probably benign Het
S1pr4 C T 10: 81,334,326 (GRCm39) V383I possibly damaging Het
Scn7a T C 2: 66,506,494 (GRCm39) D1465G probably damaging Het
Smarca4 T A 9: 21,558,655 (GRCm39) D607E possibly damaging Het
Srbd1 T A 17: 86,292,882 (GRCm39) I896L possibly damaging Het
Sulf2 G T 2: 165,921,456 (GRCm39) N722K possibly damaging Het
Surf1 A G 2: 26,806,280 (GRCm39) Y22H probably benign Het
Syngr2 A G 11: 117,703,982 (GRCm39) T150A probably benign Het
Szt2 G T 4: 118,223,416 (GRCm39) H3056N unknown Het
Tmf1 A T 6: 97,138,372 (GRCm39) S849T probably benign Het
Tns1 T A 1: 74,130,490 (GRCm39) probably benign Het
Trio G T 15: 27,774,172 (GRCm39) P1764Q probably damaging Het
Trpc3 A T 3: 36,694,821 (GRCm39) V711D probably damaging Het
Ttll3 G T 6: 113,386,298 (GRCm39) K710N probably damaging Het
Unc13c A G 9: 73,388,391 (GRCm39) S2132P possibly damaging Het
Utp20 G A 10: 88,636,998 (GRCm39) P738S possibly damaging Het
Vmn2r76 C T 7: 85,877,892 (GRCm39) V502I probably benign Het
Vsig1 C T X: 139,833,875 (GRCm39) H232Y probably benign Het
Wdr64 T G 1: 175,591,511 (GRCm39) F390V probably damaging Het
Ybx3 T G 6: 131,344,826 (GRCm39) T341P possibly damaging Het
Zdhhc11 C A 13: 74,121,866 (GRCm39) Q126K possibly damaging Het
Zfp777 G A 6: 48,002,072 (GRCm39) P673S probably damaging Het
Other mutations in Cachd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Cachd1 APN 4 100,824,163 (GRCm39) missense probably benign 0.05
IGL01531:Cachd1 APN 4 100,810,231 (GRCm39) missense probably benign 0.02
IGL01705:Cachd1 APN 4 100,840,736 (GRCm39) missense possibly damaging 0.46
IGL01843:Cachd1 APN 4 100,850,069 (GRCm39) missense probably damaging 0.98
IGL01938:Cachd1 APN 4 100,831,325 (GRCm39) missense possibly damaging 0.59
IGL02268:Cachd1 APN 4 100,809,294 (GRCm39) missense possibly damaging 0.75
IGL02934:Cachd1 APN 4 100,825,295 (GRCm39) missense probably damaging 0.98
IGL03019:Cachd1 APN 4 100,809,282 (GRCm39) missense probably damaging 0.98
IGL03084:Cachd1 APN 4 100,860,285 (GRCm39) missense probably damaging 0.99
R0366:Cachd1 UTSW 4 100,851,934 (GRCm39) missense possibly damaging 0.94
R0395:Cachd1 UTSW 4 100,810,402 (GRCm39) missense probably damaging 1.00
R0520:Cachd1 UTSW 4 100,754,900 (GRCm39) missense probably damaging 0.99
R0578:Cachd1 UTSW 4 100,852,039 (GRCm39) splice site probably benign
R0646:Cachd1 UTSW 4 100,845,418 (GRCm39) missense probably damaging 1.00
R0689:Cachd1 UTSW 4 100,832,073 (GRCm39) missense probably damaging 1.00
R0962:Cachd1 UTSW 4 100,840,498 (GRCm39) splice site probably benign
R1156:Cachd1 UTSW 4 100,845,816 (GRCm39) missense probably damaging 1.00
R1157:Cachd1 UTSW 4 100,832,037 (GRCm39) missense possibly damaging 0.77
R1314:Cachd1 UTSW 4 100,832,114 (GRCm39) missense probably damaging 1.00
R1482:Cachd1 UTSW 4 100,845,795 (GRCm39) missense possibly damaging 0.94
R1632:Cachd1 UTSW 4 100,824,169 (GRCm39) missense probably benign 0.02
R1774:Cachd1 UTSW 4 100,821,632 (GRCm39) missense probably damaging 1.00
R1774:Cachd1 UTSW 4 100,824,240 (GRCm39) missense probably benign 0.02
R1845:Cachd1 UTSW 4 100,634,555 (GRCm39) missense probably benign 0.01
R1869:Cachd1 UTSW 4 100,840,587 (GRCm39) missense probably damaging 1.00
R1912:Cachd1 UTSW 4 100,810,366 (GRCm39) missense probably damaging 0.99
R2069:Cachd1 UTSW 4 100,848,041 (GRCm39) missense probably damaging 1.00
R2082:Cachd1 UTSW 4 100,860,155 (GRCm39) missense probably damaging 1.00
R2267:Cachd1 UTSW 4 100,806,266 (GRCm39) splice site probably benign
R2517:Cachd1 UTSW 4 100,838,079 (GRCm39) splice site probably null
R2896:Cachd1 UTSW 4 100,828,100 (GRCm39) missense probably damaging 1.00
R3729:Cachd1 UTSW 4 100,832,077 (GRCm39) nonsense probably null
R3818:Cachd1 UTSW 4 100,848,062 (GRCm39) missense probably damaging 1.00
R3979:Cachd1 UTSW 4 100,828,085 (GRCm39) missense probably damaging 1.00
R4647:Cachd1 UTSW 4 100,810,327 (GRCm39) nonsense probably null
R4791:Cachd1 UTSW 4 100,775,282 (GRCm39) missense probably damaging 1.00
R5133:Cachd1 UTSW 4 100,851,935 (GRCm39) missense probably damaging 0.98
R5147:Cachd1 UTSW 4 100,821,688 (GRCm39) missense probably damaging 1.00
R5187:Cachd1 UTSW 4 100,823,397 (GRCm39) missense possibly damaging 0.94
R5322:Cachd1 UTSW 4 100,809,319 (GRCm39) missense probably damaging 0.98
R5335:Cachd1 UTSW 4 100,825,282 (GRCm39) missense possibly damaging 0.88
R5390:Cachd1 UTSW 4 100,838,203 (GRCm39) missense probably damaging 1.00
R5573:Cachd1 UTSW 4 100,831,276 (GRCm39) missense probably damaging 0.99
R5578:Cachd1 UTSW 4 100,722,203 (GRCm39) missense probably benign 0.31
R5905:Cachd1 UTSW 4 100,840,753 (GRCm39) missense probably damaging 0.99
R6003:Cachd1 UTSW 4 100,809,216 (GRCm39) missense possibly damaging 0.79
R6028:Cachd1 UTSW 4 100,840,753 (GRCm39) missense probably damaging 0.99
R6185:Cachd1 UTSW 4 100,838,228 (GRCm39) nonsense probably null
R6367:Cachd1 UTSW 4 100,860,167 (GRCm39) missense probably damaging 1.00
R6492:Cachd1 UTSW 4 100,809,315 (GRCm39) missense possibly damaging 0.89
R6591:Cachd1 UTSW 4 100,846,683 (GRCm39) missense probably benign
R6691:Cachd1 UTSW 4 100,846,683 (GRCm39) missense probably benign
R7129:Cachd1 UTSW 4 100,775,263 (GRCm39) missense probably null 0.99
R7187:Cachd1 UTSW 4 100,833,552 (GRCm39) missense possibly damaging 0.95
R7387:Cachd1 UTSW 4 100,634,375 (GRCm39) missense unknown
R7835:Cachd1 UTSW 4 100,831,350 (GRCm39) splice site probably null
R7838:Cachd1 UTSW 4 100,824,211 (GRCm39) missense possibly damaging 0.71
R7867:Cachd1 UTSW 4 100,845,759 (GRCm39) missense probably damaging 0.97
R7882:Cachd1 UTSW 4 100,824,244 (GRCm39) missense probably benign 0.29
R7941:Cachd1 UTSW 4 100,845,370 (GRCm39) missense probably damaging 1.00
R7978:Cachd1 UTSW 4 100,832,060 (GRCm39) missense probably damaging 1.00
R8085:Cachd1 UTSW 4 100,845,361 (GRCm39) missense probably damaging 1.00
R8153:Cachd1 UTSW 4 100,845,835 (GRCm39) critical splice donor site probably null
R8174:Cachd1 UTSW 4 100,823,466 (GRCm39) missense probably damaging 0.99
R8219:Cachd1 UTSW 4 100,848,159 (GRCm39) missense probably benign 0.34
R8358:Cachd1 UTSW 4 100,816,668 (GRCm39) missense possibly damaging 0.94
R8376:Cachd1 UTSW 4 100,832,073 (GRCm39) missense probably damaging 0.99
R8686:Cachd1 UTSW 4 100,845,325 (GRCm39) missense probably damaging 0.99
R8747:Cachd1 UTSW 4 100,860,045 (GRCm39) intron probably benign
R8845:Cachd1 UTSW 4 100,810,343 (GRCm39) missense probably benign 0.36
R8864:Cachd1 UTSW 4 100,852,026 (GRCm39) missense probably damaging 0.99
R8869:Cachd1 UTSW 4 100,809,280 (GRCm39) missense probably benign 0.09
R8870:Cachd1 UTSW 4 100,754,978 (GRCm39) missense probably damaging 0.99
R8904:Cachd1 UTSW 4 100,810,363 (GRCm39) missense probably damaging 1.00
R8958:Cachd1 UTSW 4 100,851,283 (GRCm39) missense probably benign 0.11
R9061:Cachd1 UTSW 4 100,809,202 (GRCm39) critical splice acceptor site probably null
R9193:Cachd1 UTSW 4 100,634,339 (GRCm39) missense unknown
R9304:Cachd1 UTSW 4 100,824,179 (GRCm39) missense possibly damaging 0.81
R9358:Cachd1 UTSW 4 100,833,622 (GRCm39) missense probably damaging 0.99
R9373:Cachd1 UTSW 4 100,832,067 (GRCm39) missense possibly damaging 0.94
R9425:Cachd1 UTSW 4 100,832,057 (GRCm39) missense probably benign
R9632:Cachd1 UTSW 4 100,832,092 (GRCm39) missense probably benign 0.34
R9710:Cachd1 UTSW 4 100,832,092 (GRCm39) missense probably benign 0.34
R9751:Cachd1 UTSW 4 100,823,438 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACCTGCTGGGAAGGTTTTGAAG -3'
(R):5'- ACTGCCCATTACTGTATGTGC -3'

Sequencing Primer
(F):5'- AAGAAGTACTTGGGCTTGGC -3'
(R):5'- ACTCTCTGGGCTTAGGAGGAATC -3'
Posted On 2019-12-20