Mutagenetix > Incidental Mutation

Incidental Mutation 'R7833:Cachd1'

605767

Institutional Source

Beutler Lab

Gene Symbol

Cachd1

Ensembl Gene

ENSMUSG00000028532

Gene Name

cache domain containing 1

Synonyms

Vwcd1, B430218L07Rik, 1190007F10Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.295) question?

Stock #

R7833 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100776675-101029220 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 100974815 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 725 (V725I)

Ref Sequence

ENSEMBL: ENSMUSP00000030257 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030257] [ENSMUST00000097955]

AlphaFold

Q6PDJ1

Predicted Effect

probably benign
Transcript: ENSMUST00000030257
AA Change: V725I

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000030257
Gene: ENSMUSG00000028532
AA Change: V725I

Domain	Start	End	E-Value	Type
low complexity region	11	24	N/A	INTRINSIC
Pfam:VWA_N	103	218	9.4e-22	PFAM
VWA	240	438	2.8e-1	SMART
Pfam:Cache_1	467	543	2.4e-12	PFAM
Pfam:Cache_1	786	871	1.5e-7	PFAM
low complexity region	981	996	N/A	INTRINSIC
transmembrane domain	1109	1131	N/A	INTRINSIC
low complexity region	1159	1173	N/A	INTRINSIC
low complexity region	1240	1246	N/A	INTRINSIC
low complexity region	1260	1274	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000097955
AA Change: V725I

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000095568
Gene: ENSMUSG00000028532
AA Change: V725I

Domain	Start	End	E-Value	Type
low complexity region	11	24	N/A	INTRINSIC
Pfam:VWA_N	103	218	6.7e-32	PFAM
VWA	240	438	2.8e-1	SMART
Pfam:Cache_1	467	543	1.7e-12	PFAM
low complexity region	801	818	N/A	INTRINSIC
low complexity region	981	996	N/A	INTRINSIC
transmembrane domain	1109	1131	N/A	INTRINSIC
low complexity region	1159	1173	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (71/71)

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	T	C	13: 64,312,278	S84G	probably benign	Het
Acin1	A	T	14: 54,664,602	S578T	possibly damaging	Het
Acot5	A	G	12: 84,075,827	Q395R	probably damaging	Het
Adamts15	T	A	9: 30,922,105	T45S	probably benign	Het
Agbl2	A	G	2: 90,815,433	K837E	probably benign	Het
Atf2	T	C	2: 73,853,885	T19A	possibly damaging	Het
Atp6v0a2	T	C	5: 124,645,031	V238A	probably damaging	Het
Atp9a	A	T	2: 168,674,857	V430E	probably benign	Het
Ccnb1	G	A	13: 100,781,351	T247M	probably damaging	Het
Cd40	A	T	2: 165,066,511	D169V	probably benign	Het
Cdc25c	G	A	18: 34,747,243	T146I	probably benign	Het
Ceacam3	C	A	7: 17,159,853	Q430K		Het
Cerkl	G	A	2: 79,341,380	T378I	probably benign	Het
Cpn2	G	T	16: 30,260,345	N179K	probably damaging	Het
Duox1	A	G	2: 122,324,388	D418G	probably damaging	Het
Eps8l1	C	A	7: 4,468,867	P11T	possibly damaging	Het
Erc1	C	T	6: 119,824,486	W190*	probably null	Het
Exosc7	A	T	9: 123,130,919	E195V	probably benign	Het
F2rl2	A	G	13: 95,700,918	N157S	probably damaging	Het
Fgd2	T	C	17: 29,367,395	L270P	possibly damaging	Het
Fitm2	A	T	2: 163,470,099	W65R	probably damaging	Het
Gabbr1	T	G	17: 37,056,969	I437S	possibly damaging	Het
Galntl6	A	T	8: 57,857,537	S377T	probably benign	Het
Gm17727	T	A	9: 35,777,110	S60C	probably damaging	Het
Gm21936	G	A	12: 87,795,552	R14K	unknown	Het
Gm281	A	T	14: 13,896,968		probably null	Het
Gm340	A	G	19: 41,584,585	D593G	probably benign	Het
Gml2	T	A	15: 74,821,368	C73*	probably null	Het
Htr6	G	T	4: 139,061,831	F304L	probably damaging	Het
Hydin	G	A	8: 110,589,460	G4328D	probably damaging	Het
Kcnj14	T	C	7: 45,817,893	D343G	probably damaging	Het
Klhdc1	T	A	12: 69,283,168	I357N	probably benign	Het
Man2a1	A	G	17: 64,666,751	T341A	probably damaging	Het
Mrm1	A	C	11: 84,818,643	V196G	probably damaging	Het
Mybbp1a	A	G	11: 72,442,901		probably null	Het
Myo19	G	A	11: 84,909,267	C826Y	probably benign	Het
Nbea	A	G	3: 56,002,797	W1326R	probably damaging	Het
Notch1	A	G	2: 26,459,533	*2532Q	probably null	Het
Npas2	A	G	1: 39,326,147	Y287C	probably damaging	Het
Olfr1016	T	A	2: 85,799,949	D107V	probably benign	Het
Olfr401	G	A	11: 74,121,837	D183N	probably damaging	Het
Pcdhga7	C	A	18: 37,716,024	D361E	possibly damaging	Het
Pde10a	T	A	17: 8,961,920	Y447N	possibly damaging	Het
Piwil2	T	A	14: 70,395,441	I561F	probably benign	Het
Pml	C	A	9: 58,234,685	R288L	probably benign	Het
Ppp4r4	A	G	12: 103,598,148	T591A	probably benign	Het
Ptprb	A	G	10: 116,315,251	T273A	probably benign	Het
Ptpro	T	A	6: 137,416,863	L843*	probably null	Het
Qrfpr	T	C	3: 36,189,602	I117V	probably benign	Het
Qrich2	T	C	11: 116,455,765	D1411G	probably benign	Het
Rad51ap2	T	C	12: 11,456,655	S193P	probably benign	Het
Raver1	T	C	9: 21,081,314	E273G	probably benign	Het
Rubcn	C	A	16: 32,868,274		probably benign	Het
S1pr4	C	T	10: 81,498,492	V383I	possibly damaging	Het
Scn7a	T	C	2: 66,676,150	D1465G	probably damaging	Het
Smarca4	T	A	9: 21,647,359	D607E	possibly damaging	Het
Srbd1	T	A	17: 85,985,454	I896L	possibly damaging	Het
Sulf2	G	T	2: 166,079,536	N722K	possibly damaging	Het
Surf1	A	G	2: 26,916,268	Y22H	probably benign	Het
Syngr2	A	G	11: 117,813,156	T150A	probably benign	Het
Szt2	G	T	4: 118,366,219	H3056N	unknown	Het
Tmf1	A	T	6: 97,161,411	S849T	probably benign	Het
Tns1	T	A	1: 74,091,331		probably benign	Het
Trio	G	T	15: 27,774,086	P1764Q	probably damaging	Het
Trpc3	A	T	3: 36,640,672	V711D	probably damaging	Het
Ttll3	G	T	6: 113,409,337	K710N	probably damaging	Het
Unc13c	A	G	9: 73,481,109	S2132P	possibly damaging	Het
Utp20	G	A	10: 88,801,136	P738S	possibly damaging	Het
Vmn2r76	C	T	7: 86,228,684	V502I	probably benign	Het
Vsig1	C	T	X: 140,933,126	H232Y	probably benign	Het
Wdr64	T	G	1: 175,763,945	F390V	probably damaging	Het
Ybx3	T	G	6: 131,367,863	T341P	possibly damaging	Het
Zdhhc11	C	A	13: 73,973,747	Q126K	possibly damaging	Het
Zfp777	G	A	6: 48,025,138	P673S	probably damaging	Het

Other mutations in Cachd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Cachd1	APN	4	100966966	missense	probably benign	0.05
IGL01531:Cachd1	APN	4	100953034	missense	probably benign	0.02
IGL01705:Cachd1	APN	4	100983539	missense	possibly damaging	0.46
IGL01843:Cachd1	APN	4	100992872	missense	probably damaging	0.98
IGL01938:Cachd1	APN	4	100974128	missense	possibly damaging	0.59
IGL02268:Cachd1	APN	4	100952097	missense	possibly damaging	0.75
IGL02934:Cachd1	APN	4	100968098	missense	probably damaging	0.98
IGL03019:Cachd1	APN	4	100952085	missense	probably damaging	0.98
IGL03084:Cachd1	APN	4	101003088	missense	probably damaging	0.99
R0366:Cachd1	UTSW	4	100994737	missense	possibly damaging	0.94
R0395:Cachd1	UTSW	4	100953205	missense	probably damaging	1.00
R0520:Cachd1	UTSW	4	100897703	missense	probably damaging	0.99
R0578:Cachd1	UTSW	4	100994842	splice site	probably benign
R0646:Cachd1	UTSW	4	100988221	missense	probably damaging	1.00
R0689:Cachd1	UTSW	4	100974876	missense	probably damaging	1.00
R0962:Cachd1	UTSW	4	100983301	splice site	probably benign
R1156:Cachd1	UTSW	4	100988619	missense	probably damaging	1.00
R1157:Cachd1	UTSW	4	100974840	missense	possibly damaging	0.77
R1314:Cachd1	UTSW	4	100974917	missense	probably damaging	1.00
R1482:Cachd1	UTSW	4	100988598	missense	possibly damaging	0.94
R1632:Cachd1	UTSW	4	100966972	missense	probably benign	0.02
R1774:Cachd1	UTSW	4	100964435	missense	probably damaging	1.00
R1774:Cachd1	UTSW	4	100967043	missense	probably benign	0.02
R1845:Cachd1	UTSW	4	100777358	missense	probably benign	0.01
R1869:Cachd1	UTSW	4	100983390	missense	probably damaging	1.00
R1912:Cachd1	UTSW	4	100953169	missense	probably damaging	0.99
R2069:Cachd1	UTSW	4	100990844	missense	probably damaging	1.00
R2082:Cachd1	UTSW	4	101002958	missense	probably damaging	1.00
R2267:Cachd1	UTSW	4	100949069	splice site	probably benign
R2517:Cachd1	UTSW	4	100980882	splice site	probably null
R2896:Cachd1	UTSW	4	100970903	missense	probably damaging	1.00
R3729:Cachd1	UTSW	4	100974880	nonsense	probably null
R3818:Cachd1	UTSW	4	100990865	missense	probably damaging	1.00
R3979:Cachd1	UTSW	4	100970888	missense	probably damaging	1.00
R4647:Cachd1	UTSW	4	100953130	nonsense	probably null
R4791:Cachd1	UTSW	4	100918085	missense	probably damaging	1.00
R5133:Cachd1	UTSW	4	100994738	missense	probably damaging	0.98
R5147:Cachd1	UTSW	4	100964491	missense	probably damaging	1.00
R5187:Cachd1	UTSW	4	100966200	missense	possibly damaging	0.94
R5322:Cachd1	UTSW	4	100952122	missense	probably damaging	0.98
R5335:Cachd1	UTSW	4	100968085	missense	possibly damaging	0.88
R5390:Cachd1	UTSW	4	100981006	missense	probably damaging	1.00
R5573:Cachd1	UTSW	4	100974079	missense	probably damaging	0.99
R5578:Cachd1	UTSW	4	100865006	missense	probably benign	0.31
R5905:Cachd1	UTSW	4	100983556	missense	probably damaging	0.99
R6003:Cachd1	UTSW	4	100952019	missense	possibly damaging	0.79
R6028:Cachd1	UTSW	4	100983556	missense	probably damaging	0.99
R6185:Cachd1	UTSW	4	100981031	nonsense	probably null
R6367:Cachd1	UTSW	4	101002970	missense	probably damaging	1.00
R6492:Cachd1	UTSW	4	100952118	missense	possibly damaging	0.89
R6591:Cachd1	UTSW	4	100989486	missense	probably benign
R6691:Cachd1	UTSW	4	100989486	missense	probably benign
R7129:Cachd1	UTSW	4	100918066	missense	probably null	0.99
R7187:Cachd1	UTSW	4	100976355	missense	possibly damaging	0.95
R7387:Cachd1	UTSW	4	100777178	missense	unknown
R7835:Cachd1	UTSW	4	100974153	splice site	probably null
R7838:Cachd1	UTSW	4	100967014	missense	possibly damaging	0.71
R7867:Cachd1	UTSW	4	100988562	missense	probably damaging	0.97
R7882:Cachd1	UTSW	4	100967047	missense	probably benign	0.29
R7941:Cachd1	UTSW	4	100988173	missense	probably damaging	1.00
R7978:Cachd1	UTSW	4	100974863	missense	probably damaging	1.00
R8085:Cachd1	UTSW	4	100988164	missense	probably damaging	1.00
R8153:Cachd1	UTSW	4	100988638	critical splice donor site	probably null
R8174:Cachd1	UTSW	4	100966269	missense	probably damaging	0.99
R8219:Cachd1	UTSW	4	100990962	missense	probably benign	0.34
R8358:Cachd1	UTSW	4	100959471	missense	possibly damaging	0.94
R8376:Cachd1	UTSW	4	100974876	missense	probably damaging	0.99
R8686:Cachd1	UTSW	4	100988128	missense	probably damaging	0.99
R8747:Cachd1	UTSW	4	101002848	intron	probably benign
R8845:Cachd1	UTSW	4	100953146	missense	probably benign	0.36
R8864:Cachd1	UTSW	4	100994829	missense	probably damaging	0.99
R8869:Cachd1	UTSW	4	100952083	missense	probably benign	0.09
R8870:Cachd1	UTSW	4	100897781	missense	probably damaging	0.99
R8904:Cachd1	UTSW	4	100953166	missense	probably damaging	1.00
R8958:Cachd1	UTSW	4	100994086	missense	probably benign	0.11
R9061:Cachd1	UTSW	4	100952005	critical splice acceptor site	probably null
R9193:Cachd1	UTSW	4	100777142	missense	unknown
R9304:Cachd1	UTSW	4	100966982	missense	possibly damaging	0.81
R9358:Cachd1	UTSW	4	100976425	missense	probably damaging	0.99
R9373:Cachd1	UTSW	4	100974870	missense	possibly damaging	0.94
R9425:Cachd1	UTSW	4	100974860	missense	probably benign
R9632:Cachd1	UTSW	4	100974895	missense	probably benign	0.34
R9710:Cachd1	UTSW	4	100974895	missense	probably benign	0.34
R9751:Cachd1	UTSW	4	100966241	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- ACCTGCTGGGAAGGTTTTGAAG -3'
(R):5'- ACTGCCCATTACTGTATGTGC -3'

Sequencing Primer
(F):5'- AAGAAGTACTTGGGCTTGGC -3'
(R):5'- ACTCTCTGGGCTTAGGAGGAATC -3'

Posted On

2019-12-20