Incidental Mutation 'R7833:Ttll3'
ID 605773
Institutional Source Beutler Lab
Gene Symbol Ttll3
Ensembl Gene ENSMUSG00000030276
Gene Name tubulin tyrosine ligase-like family, member 3
Synonyms 4833441J24Rik
MMRRC Submission 045887-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7833 (G1)
Quality Score 166.009
Status Validated
Chromosome 6
Chromosomal Location 113366221-113391548 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 113386298 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 710 (K710N)
Ref Sequence ENSEMBL: ENSMUSP00000032414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032414] [ENSMUST00000038889] [ENSMUST00000205017]
AlphaFold A4Q9E5
Predicted Effect probably damaging
Transcript: ENSMUST00000032414
AA Change: K710N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032414
Gene: ENSMUSG00000030276
AA Change: K710N

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 698 7.7e-84 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000038889
AA Change: K711N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037870
Gene: ENSMUSG00000030276
AA Change: K711N

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 699 9e-85 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000205017
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduced number of primary cilia in colon epithelia accompanied by an increased rate of cell division which is compensated by faster tissue turnover in the colon. Mice exhibit increased incidence of colon tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,902,059 (GRCm39) S578T possibly damaging Het
Acot5 A G 12: 84,122,601 (GRCm39) Q395R probably damaging Het
Adamts15 T A 9: 30,833,401 (GRCm39) T45S probably benign Het
Agbl2 A G 2: 90,645,777 (GRCm39) K837E probably benign Het
Atf2 T C 2: 73,684,229 (GRCm39) T19A possibly damaging Het
Atp6v0a2 T C 5: 124,782,969 (GRCm39) V238A probably damaging Het
Atp9a A T 2: 168,516,777 (GRCm39) V430E probably benign Het
Cachd1 G A 4: 100,832,012 (GRCm39) V725I probably benign Het
Ccnb1 G A 13: 100,917,859 (GRCm39) T247M probably damaging Het
Cd40 A T 2: 164,908,431 (GRCm39) D169V probably benign Het
Cdc25c G A 18: 34,880,296 (GRCm39) T146I probably benign Het
Cdhr18 A T 14: 13,896,968 (GRCm38) probably null Het
Ceacam3 C A 7: 16,893,778 (GRCm39) Q430K Het
Cerkl G A 2: 79,171,724 (GRCm39) T378I probably benign Het
Cpn2 G T 16: 30,079,163 (GRCm39) N179K probably damaging Het
Duox1 A G 2: 122,154,869 (GRCm39) D418G probably damaging Het
Eif1ad13 G A 12: 87,762,322 (GRCm39) R14K unknown Het
Eps8l1 C A 7: 4,471,866 (GRCm39) P11T possibly damaging Het
Erc1 C T 6: 119,801,447 (GRCm39) W190* probably null Het
Exosc7 A T 9: 122,959,984 (GRCm39) E195V probably benign Het
F2rl2 A G 13: 95,837,426 (GRCm39) N157S probably damaging Het
Fgd2 T C 17: 29,586,369 (GRCm39) L270P possibly damaging Het
Fitm2 A T 2: 163,312,019 (GRCm39) W65R probably damaging Het
Gabbr1 T G 17: 37,367,861 (GRCm39) I437S possibly damaging Het
Galntl6 A T 8: 58,310,571 (GRCm39) S377T probably benign Het
Gml2 T A 15: 74,693,217 (GRCm39) C73* probably null Het
Htr6 G T 4: 138,789,142 (GRCm39) F304L probably damaging Het
Hydin G A 8: 111,316,092 (GRCm39) G4328D probably damaging Het
Kcnj14 T C 7: 45,467,317 (GRCm39) D343G probably damaging Het
Klhdc1 T A 12: 69,329,942 (GRCm39) I357N probably benign Het
Lcor A G 19: 41,573,024 (GRCm39) D593G probably benign Het
Man2a1 A G 17: 64,973,746 (GRCm39) T341A probably damaging Het
Mrm1 A C 11: 84,709,469 (GRCm39) V196G probably damaging Het
Mybbp1a A G 11: 72,333,727 (GRCm39) probably null Het
Myo19 G A 11: 84,800,093 (GRCm39) C826Y probably benign Het
Nbea A G 3: 55,910,218 (GRCm39) W1326R probably damaging Het
Notch1 A G 2: 26,349,545 (GRCm39) *2532Q probably null Het
Npas2 A G 1: 39,365,228 (GRCm39) Y287C probably damaging Het
Or3a1b G A 11: 74,012,663 (GRCm39) D183N probably damaging Het
Or9g20 T A 2: 85,630,293 (GRCm39) D107V probably benign Het
Pate7 T A 9: 35,688,406 (GRCm39) S60C probably damaging Het
Pcdhga7 C A 18: 37,849,077 (GRCm39) D361E possibly damaging Het
Pde10a T A 17: 9,180,752 (GRCm39) Y447N possibly damaging Het
Piwil2 T A 14: 70,632,890 (GRCm39) I561F probably benign Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Ppp4r4 A G 12: 103,564,407 (GRCm39) T591A probably benign Het
Prxl2c T C 13: 64,460,092 (GRCm39) S84G probably benign Het
Ptprb A G 10: 116,151,156 (GRCm39) T273A probably benign Het
Ptpro T A 6: 137,393,861 (GRCm39) L843* probably null Het
Qrfpr T C 3: 36,243,751 (GRCm39) I117V probably benign Het
Qrich2 T C 11: 116,346,591 (GRCm39) D1411G probably benign Het
Rad51ap2 T C 12: 11,506,656 (GRCm39) S193P probably benign Het
Raver1 T C 9: 20,992,610 (GRCm39) E273G probably benign Het
Rubcn C A 16: 32,688,644 (GRCm39) probably benign Het
S1pr4 C T 10: 81,334,326 (GRCm39) V383I possibly damaging Het
Scn7a T C 2: 66,506,494 (GRCm39) D1465G probably damaging Het
Smarca4 T A 9: 21,558,655 (GRCm39) D607E possibly damaging Het
Srbd1 T A 17: 86,292,882 (GRCm39) I896L possibly damaging Het
Sulf2 G T 2: 165,921,456 (GRCm39) N722K possibly damaging Het
Surf1 A G 2: 26,806,280 (GRCm39) Y22H probably benign Het
Syngr2 A G 11: 117,703,982 (GRCm39) T150A probably benign Het
Szt2 G T 4: 118,223,416 (GRCm39) H3056N unknown Het
Tmf1 A T 6: 97,138,372 (GRCm39) S849T probably benign Het
Tns1 T A 1: 74,130,490 (GRCm39) probably benign Het
Trio G T 15: 27,774,172 (GRCm39) P1764Q probably damaging Het
Trpc3 A T 3: 36,694,821 (GRCm39) V711D probably damaging Het
Unc13c A G 9: 73,388,391 (GRCm39) S2132P possibly damaging Het
Utp20 G A 10: 88,636,998 (GRCm39) P738S possibly damaging Het
Vmn2r76 C T 7: 85,877,892 (GRCm39) V502I probably benign Het
Vsig1 C T X: 139,833,875 (GRCm39) H232Y probably benign Het
Wdr64 T G 1: 175,591,511 (GRCm39) F390V probably damaging Het
Ybx3 T G 6: 131,344,826 (GRCm39) T341P possibly damaging Het
Zdhhc11 C A 13: 74,121,866 (GRCm39) Q126K possibly damaging Het
Zfp777 G A 6: 48,002,072 (GRCm39) P673S probably damaging Het
Other mutations in Ttll3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Ttll3 APN 6 113,371,690 (GRCm39) missense probably damaging 1.00
IGL01677:Ttll3 APN 6 113,389,945 (GRCm39) missense probably benign
IGL01697:Ttll3 APN 6 113,376,690 (GRCm39) missense probably benign 0.00
IGL01944:Ttll3 APN 6 113,391,076 (GRCm39) missense probably benign
IGL02688:Ttll3 APN 6 113,376,700 (GRCm39) missense probably benign 0.00
IGL03068:Ttll3 APN 6 113,386,158 (GRCm39) missense probably damaging 1.00
R0373:Ttll3 UTSW 6 113,375,738 (GRCm39) missense probably damaging 1.00
R0472:Ttll3 UTSW 6 113,386,300 (GRCm39) missense probably damaging 1.00
R0625:Ttll3 UTSW 6 113,385,864 (GRCm39) critical splice acceptor site probably null
R1868:Ttll3 UTSW 6 113,369,725 (GRCm39) missense possibly damaging 0.95
R2026:Ttll3 UTSW 6 113,375,731 (GRCm39) missense probably damaging 1.00
R2061:Ttll3 UTSW 6 113,386,003 (GRCm39) missense possibly damaging 0.76
R2128:Ttll3 UTSW 6 113,389,895 (GRCm39) missense probably benign 0.31
R2896:Ttll3 UTSW 6 113,369,683 (GRCm39) missense probably benign 0.15
R2903:Ttll3 UTSW 6 113,384,284 (GRCm39) missense probably damaging 0.99
R2906:Ttll3 UTSW 6 113,369,471 (GRCm39) unclassified probably benign
R4659:Ttll3 UTSW 6 113,391,102 (GRCm39) missense probably benign
R4746:Ttll3 UTSW 6 113,384,353 (GRCm39) missense probably damaging 1.00
R4984:Ttll3 UTSW 6 113,389,901 (GRCm39) missense probably benign 0.00
R5358:Ttll3 UTSW 6 113,378,292 (GRCm39) missense probably benign 0.26
R5372:Ttll3 UTSW 6 113,378,382 (GRCm39) nonsense probably null
R5525:Ttll3 UTSW 6 113,389,939 (GRCm39) missense probably benign
R5548:Ttll3 UTSW 6 113,370,078 (GRCm39) missense probably damaging 1.00
R5694:Ttll3 UTSW 6 113,376,669 (GRCm39) missense probably damaging 1.00
R5993:Ttll3 UTSW 6 113,374,992 (GRCm39) nonsense probably null
R6119:Ttll3 UTSW 6 113,371,702 (GRCm39) missense probably damaging 1.00
R6268:Ttll3 UTSW 6 113,369,524 (GRCm39) missense probably benign 0.00
R6719:Ttll3 UTSW 6 113,375,993 (GRCm39) intron probably benign
R6852:Ttll3 UTSW 6 113,376,120 (GRCm39) frame shift probably null
R6852:Ttll3 UTSW 6 113,376,116 (GRCm39) frame shift probably null
R6852:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R6853:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R6854:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7170:Ttll3 UTSW 6 113,390,839 (GRCm39) missense probably benign 0.41
R7239:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7302:Ttll3 UTSW 6 113,386,246 (GRCm39) missense probably damaging 1.00
R7330:Ttll3 UTSW 6 113,376,125 (GRCm39) frame shift probably null
R7330:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7586:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7587:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7701:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7702:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7776:Ttll3 UTSW 6 113,376,120 (GRCm39) frame shift probably null
R7793:Ttll3 UTSW 6 113,376,120 (GRCm39) frame shift probably null
R7797:Ttll3 UTSW 6 113,371,738 (GRCm39) missense possibly damaging 0.76
R7824:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7825:Ttll3 UTSW 6 113,376,120 (GRCm39) frame shift probably null
R7825:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7826:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7827:Ttll3 UTSW 6 113,376,123 (GRCm39) frame shift probably null
R7827:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7831:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7832:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R7966:Ttll3 UTSW 6 113,376,118 (GRCm39) frame shift probably null
R8344:Ttll3 UTSW 6 113,371,959 (GRCm39) missense probably damaging 1.00
R8418:Ttll3 UTSW 6 113,371,734 (GRCm39) missense probably benign 0.04
R8768:Ttll3 UTSW 6 113,385,949 (GRCm39) missense probably damaging 1.00
R9017:Ttll3 UTSW 6 113,389,850 (GRCm39) missense probably benign 0.00
R9036:Ttll3 UTSW 6 113,376,657 (GRCm39) missense possibly damaging 0.47
R9090:Ttll3 UTSW 6 113,369,596 (GRCm39) missense probably benign
R9271:Ttll3 UTSW 6 113,369,596 (GRCm39) missense probably benign
R9329:Ttll3 UTSW 6 113,369,635 (GRCm39) missense probably benign
R9532:Ttll3 UTSW 6 113,385,970 (GRCm39) missense possibly damaging 0.69
R9535:Ttll3 UTSW 6 113,389,834 (GRCm39) missense probably damaging 1.00
R9725:Ttll3 UTSW 6 113,386,114 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATAACGTGCAGTGCCGG -3'
(R):5'- CTCAGACCTGACTGTAACCTC -3'

Sequencing Primer
(F):5'- TGAGCTCTATGGGGCAGAC -3'
(R):5'- TCCAGTTCACAGATGAGTCAG -3'
Posted On 2019-12-20