Incidental Mutation 'R7833:Ybx3'
ID 605775
Institutional Source Beutler Lab
Gene Symbol Ybx3
Ensembl Gene ENSMUSG00000030189
Gene Name Y box protein 3
Synonyms dbpA, MSY4, MSY3, Dpba, Yb2, oxyR, Csda
MMRRC Submission 045887-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7833 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 131341821-131365413 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 131344826 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 341 (T341P)
Ref Sequence ENSEMBL: ENSMUSP00000032309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032309] [ENSMUST00000087865]
AlphaFold Q9JKB3
Predicted Effect possibly damaging
Transcript: ENSMUST00000032309
AA Change: T341P

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032309
Gene: ENSMUSG00000030189
AA Change: T341P

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 14 71 N/A INTRINSIC
CSP 84 152 8.65e-24 SMART
low complexity region 166 182 N/A INTRINSIC
low complexity region 186 198 N/A INTRINSIC
low complexity region 212 232 N/A INTRINSIC
low complexity region 278 293 N/A INTRINSIC
low complexity region 315 329 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087865
AA Change: T272P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085172
Gene: ENSMUSG00000030189
AA Change: T272P

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 14 71 N/A INTRINSIC
CSP 84 152 8.65e-24 SMART
low complexity region 166 182 N/A INTRINSIC
low complexity region 209 224 N/A INTRINSIC
low complexity region 246 260 N/A INTRINSIC
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Half of mice homozygous for a knock-out allele exhibit male infertility associated with smaller testes and reduced sperm production, partly due to increased spermatocyte apoptosis during mid to late spermatogenesis and progressive seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,902,059 (GRCm39) S578T possibly damaging Het
Acot5 A G 12: 84,122,601 (GRCm39) Q395R probably damaging Het
Adamts15 T A 9: 30,833,401 (GRCm39) T45S probably benign Het
Agbl2 A G 2: 90,645,777 (GRCm39) K837E probably benign Het
Atf2 T C 2: 73,684,229 (GRCm39) T19A possibly damaging Het
Atp6v0a2 T C 5: 124,782,969 (GRCm39) V238A probably damaging Het
Atp9a A T 2: 168,516,777 (GRCm39) V430E probably benign Het
Cachd1 G A 4: 100,832,012 (GRCm39) V725I probably benign Het
Ccnb1 G A 13: 100,917,859 (GRCm39) T247M probably damaging Het
Cd40 A T 2: 164,908,431 (GRCm39) D169V probably benign Het
Cdc25c G A 18: 34,880,296 (GRCm39) T146I probably benign Het
Cdhr18 A T 14: 13,896,968 (GRCm38) probably null Het
Ceacam3 C A 7: 16,893,778 (GRCm39) Q430K Het
Cerkl G A 2: 79,171,724 (GRCm39) T378I probably benign Het
Cpn2 G T 16: 30,079,163 (GRCm39) N179K probably damaging Het
Duox1 A G 2: 122,154,869 (GRCm39) D418G probably damaging Het
Eif1ad13 G A 12: 87,762,322 (GRCm39) R14K unknown Het
Eps8l1 C A 7: 4,471,866 (GRCm39) P11T possibly damaging Het
Erc1 C T 6: 119,801,447 (GRCm39) W190* probably null Het
Exosc7 A T 9: 122,959,984 (GRCm39) E195V probably benign Het
F2rl2 A G 13: 95,837,426 (GRCm39) N157S probably damaging Het
Fgd2 T C 17: 29,586,369 (GRCm39) L270P possibly damaging Het
Fitm2 A T 2: 163,312,019 (GRCm39) W65R probably damaging Het
Gabbr1 T G 17: 37,367,861 (GRCm39) I437S possibly damaging Het
Galntl6 A T 8: 58,310,571 (GRCm39) S377T probably benign Het
Gml2 T A 15: 74,693,217 (GRCm39) C73* probably null Het
Htr6 G T 4: 138,789,142 (GRCm39) F304L probably damaging Het
Hydin G A 8: 111,316,092 (GRCm39) G4328D probably damaging Het
Kcnj14 T C 7: 45,467,317 (GRCm39) D343G probably damaging Het
Klhdc1 T A 12: 69,329,942 (GRCm39) I357N probably benign Het
Lcor A G 19: 41,573,024 (GRCm39) D593G probably benign Het
Man2a1 A G 17: 64,973,746 (GRCm39) T341A probably damaging Het
Mrm1 A C 11: 84,709,469 (GRCm39) V196G probably damaging Het
Mybbp1a A G 11: 72,333,727 (GRCm39) probably null Het
Myo19 G A 11: 84,800,093 (GRCm39) C826Y probably benign Het
Nbea A G 3: 55,910,218 (GRCm39) W1326R probably damaging Het
Notch1 A G 2: 26,349,545 (GRCm39) *2532Q probably null Het
Npas2 A G 1: 39,365,228 (GRCm39) Y287C probably damaging Het
Or3a1b G A 11: 74,012,663 (GRCm39) D183N probably damaging Het
Or9g20 T A 2: 85,630,293 (GRCm39) D107V probably benign Het
Pate7 T A 9: 35,688,406 (GRCm39) S60C probably damaging Het
Pcdhga7 C A 18: 37,849,077 (GRCm39) D361E possibly damaging Het
Pde10a T A 17: 9,180,752 (GRCm39) Y447N possibly damaging Het
Piwil2 T A 14: 70,632,890 (GRCm39) I561F probably benign Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Ppp4r4 A G 12: 103,564,407 (GRCm39) T591A probably benign Het
Prxl2c T C 13: 64,460,092 (GRCm39) S84G probably benign Het
Ptprb A G 10: 116,151,156 (GRCm39) T273A probably benign Het
Ptpro T A 6: 137,393,861 (GRCm39) L843* probably null Het
Qrfpr T C 3: 36,243,751 (GRCm39) I117V probably benign Het
Qrich2 T C 11: 116,346,591 (GRCm39) D1411G probably benign Het
Rad51ap2 T C 12: 11,506,656 (GRCm39) S193P probably benign Het
Raver1 T C 9: 20,992,610 (GRCm39) E273G probably benign Het
Rubcn C A 16: 32,688,644 (GRCm39) probably benign Het
S1pr4 C T 10: 81,334,326 (GRCm39) V383I possibly damaging Het
Scn7a T C 2: 66,506,494 (GRCm39) D1465G probably damaging Het
Smarca4 T A 9: 21,558,655 (GRCm39) D607E possibly damaging Het
Srbd1 T A 17: 86,292,882 (GRCm39) I896L possibly damaging Het
Sulf2 G T 2: 165,921,456 (GRCm39) N722K possibly damaging Het
Surf1 A G 2: 26,806,280 (GRCm39) Y22H probably benign Het
Syngr2 A G 11: 117,703,982 (GRCm39) T150A probably benign Het
Szt2 G T 4: 118,223,416 (GRCm39) H3056N unknown Het
Tmf1 A T 6: 97,138,372 (GRCm39) S849T probably benign Het
Tns1 T A 1: 74,130,490 (GRCm39) probably benign Het
Trio G T 15: 27,774,172 (GRCm39) P1764Q probably damaging Het
Trpc3 A T 3: 36,694,821 (GRCm39) V711D probably damaging Het
Ttll3 G T 6: 113,386,298 (GRCm39) K710N probably damaging Het
Unc13c A G 9: 73,388,391 (GRCm39) S2132P possibly damaging Het
Utp20 G A 10: 88,636,998 (GRCm39) P738S possibly damaging Het
Vmn2r76 C T 7: 85,877,892 (GRCm39) V502I probably benign Het
Vsig1 C T X: 139,833,875 (GRCm39) H232Y probably benign Het
Wdr64 T G 1: 175,591,511 (GRCm39) F390V probably damaging Het
Zdhhc11 C A 13: 74,121,866 (GRCm39) Q126K possibly damaging Het
Zfp777 G A 6: 48,002,072 (GRCm39) P673S probably damaging Het
Other mutations in Ybx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Ybx3 APN 6 131,357,892 (GRCm39) missense probably damaging 1.00
IGL02203:Ybx3 APN 6 131,345,371 (GRCm39) missense probably benign 0.01
PIT1430001:Ybx3 UTSW 6 131,356,422 (GRCm39) missense probably damaging 1.00
R2869:Ybx3 UTSW 6 131,347,376 (GRCm39) missense probably damaging 1.00
R2869:Ybx3 UTSW 6 131,347,376 (GRCm39) missense probably damaging 1.00
R2870:Ybx3 UTSW 6 131,347,376 (GRCm39) missense probably damaging 1.00
R2870:Ybx3 UTSW 6 131,347,376 (GRCm39) missense probably damaging 1.00
R2873:Ybx3 UTSW 6 131,347,376 (GRCm39) missense probably damaging 1.00
R4654:Ybx3 UTSW 6 131,347,290 (GRCm39) missense probably damaging 0.99
R5878:Ybx3 UTSW 6 131,344,726 (GRCm39) critical splice donor site probably null
R5881:Ybx3 UTSW 6 131,345,451 (GRCm39) missense possibly damaging 0.71
R7796:Ybx3 UTSW 6 131,345,479 (GRCm39) missense probably damaging 0.98
R7986:Ybx3 UTSW 6 131,356,362 (GRCm39) nonsense probably null
R8003:Ybx3 UTSW 6 131,345,400 (GRCm39) nonsense probably null
R8043:Ybx3 UTSW 6 131,361,469 (GRCm39) missense probably benign 0.13
R9802:Ybx3 UTSW 6 131,345,426 (GRCm39) missense probably benign 0.01
X0024:Ybx3 UTSW 6 131,357,867 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGGTGCAACAGAGACCACTG -3'
(R):5'- AGTAACACAGCCATGGCACG -3'

Sequencing Primer
(F):5'- TGCGGGCACAGTGGAATC -3'
(R):5'- TGTGGACTCTTAGCACAGC -3'
Posted On 2019-12-20