Incidental Mutation 'R7833:Eps8l1'
ID 605777
Institutional Source Beutler Lab
Gene Symbol Eps8l1
Ensembl Gene ENSMUSG00000006154
Gene Name EPS8-like 1
Synonyms DRC3, EPS8R1, 4632407K17Rik, 2310051G19Rik
MMRRC Submission 045887-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7833 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 4463673-4483486 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 4471866 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 11 (P11T)
Ref Sequence ENSEMBL: ENSMUSP00000083559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086372] [ENSMUST00000163137] [ENSMUST00000163804] [ENSMUST00000163893] [ENSMUST00000167298] [ENSMUST00000167810] [ENSMUST00000169820] [ENSMUST00000170635] [ENSMUST00000171445]
AlphaFold Q8R5F8
PDB Structure Crystal structure of phosphotyrosine binding (PTB) domain of epidermal growth factor receptor pathway substrate-8 (EPS8) related protein 1 from Mus musculus (form-1 crystal) [X-RAY DIFFRACTION]
Crystal structure of phosphotyrosine binding (PTB) domain of epidermal growth factor receptor pathway substrate-8 (EPS8) related protein 1 from Mus musculus (form-2 crystal) [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086372
AA Change: P11T

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000083559
Gene: ENSMUSG00000006154
AA Change: P11T

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163137
AA Change: P11T

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131345
Gene: ENSMUSG00000006154
AA Change: P11T

DomainStartEndE-ValueType
Pfam:PTB 35 100 1.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163804
Predicted Effect possibly damaging
Transcript: ENSMUST00000163893
AA Change: P11T

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125840
Gene: ENSMUSG00000006154
AA Change: P11T

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167298
Predicted Effect possibly damaging
Transcript: ENSMUST00000167810
AA Change: P11T

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126720
Gene: ENSMUSG00000006154
AA Change: P11T

DomainStartEndE-ValueType
Pfam:PTB 35 152 5e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169820
AA Change: P11T

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131773
Gene: ENSMUSG00000006154
AA Change: P11T

DomainStartEndE-ValueType
Pfam:PTB 35 93 1.1e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170635
AA Change: P11T

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127999
Gene: ENSMUSG00000006154
AA Change: P11T

DomainStartEndE-ValueType
PDB:2CY5|A 26 52 3e-13 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000171445
AA Change: P72T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133206
Gene: ENSMUSG00000006154
AA Change: P72T

DomainStartEndE-ValueType
Pfam:PTB 96 226 5.8e-46 PFAM
low complexity region 343 365 N/A INTRINSIC
SH3 541 596 2.62e-11 SMART
low complexity region 615 625 N/A INTRINSIC
PDB:1WWU|A 693 759 1e-19 PDB
low complexity region 762 776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to epidermal growth factor receptor pathway substrate 8 (EPS8), a substrate for the epidermal growth factor receptor. The function of this protein is unknown. At least two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,902,059 (GRCm39) S578T possibly damaging Het
Acot5 A G 12: 84,122,601 (GRCm39) Q395R probably damaging Het
Adamts15 T A 9: 30,833,401 (GRCm39) T45S probably benign Het
Agbl2 A G 2: 90,645,777 (GRCm39) K837E probably benign Het
Atf2 T C 2: 73,684,229 (GRCm39) T19A possibly damaging Het
Atp6v0a2 T C 5: 124,782,969 (GRCm39) V238A probably damaging Het
Atp9a A T 2: 168,516,777 (GRCm39) V430E probably benign Het
Cachd1 G A 4: 100,832,012 (GRCm39) V725I probably benign Het
Ccnb1 G A 13: 100,917,859 (GRCm39) T247M probably damaging Het
Cd40 A T 2: 164,908,431 (GRCm39) D169V probably benign Het
Cdc25c G A 18: 34,880,296 (GRCm39) T146I probably benign Het
Cdhr18 A T 14: 13,896,968 (GRCm38) probably null Het
Ceacam3 C A 7: 16,893,778 (GRCm39) Q430K Het
Cerkl G A 2: 79,171,724 (GRCm39) T378I probably benign Het
Cpn2 G T 16: 30,079,163 (GRCm39) N179K probably damaging Het
Duox1 A G 2: 122,154,869 (GRCm39) D418G probably damaging Het
Eif1ad13 G A 12: 87,762,322 (GRCm39) R14K unknown Het
Erc1 C T 6: 119,801,447 (GRCm39) W190* probably null Het
Exosc7 A T 9: 122,959,984 (GRCm39) E195V probably benign Het
F2rl2 A G 13: 95,837,426 (GRCm39) N157S probably damaging Het
Fgd2 T C 17: 29,586,369 (GRCm39) L270P possibly damaging Het
Fitm2 A T 2: 163,312,019 (GRCm39) W65R probably damaging Het
Gabbr1 T G 17: 37,367,861 (GRCm39) I437S possibly damaging Het
Galntl6 A T 8: 58,310,571 (GRCm39) S377T probably benign Het
Gml2 T A 15: 74,693,217 (GRCm39) C73* probably null Het
Htr6 G T 4: 138,789,142 (GRCm39) F304L probably damaging Het
Hydin G A 8: 111,316,092 (GRCm39) G4328D probably damaging Het
Kcnj14 T C 7: 45,467,317 (GRCm39) D343G probably damaging Het
Klhdc1 T A 12: 69,329,942 (GRCm39) I357N probably benign Het
Lcor A G 19: 41,573,024 (GRCm39) D593G probably benign Het
Man2a1 A G 17: 64,973,746 (GRCm39) T341A probably damaging Het
Mrm1 A C 11: 84,709,469 (GRCm39) V196G probably damaging Het
Mybbp1a A G 11: 72,333,727 (GRCm39) probably null Het
Myo19 G A 11: 84,800,093 (GRCm39) C826Y probably benign Het
Nbea A G 3: 55,910,218 (GRCm39) W1326R probably damaging Het
Notch1 A G 2: 26,349,545 (GRCm39) *2532Q probably null Het
Npas2 A G 1: 39,365,228 (GRCm39) Y287C probably damaging Het
Or3a1b G A 11: 74,012,663 (GRCm39) D183N probably damaging Het
Or9g20 T A 2: 85,630,293 (GRCm39) D107V probably benign Het
Pate7 T A 9: 35,688,406 (GRCm39) S60C probably damaging Het
Pcdhga7 C A 18: 37,849,077 (GRCm39) D361E possibly damaging Het
Pde10a T A 17: 9,180,752 (GRCm39) Y447N possibly damaging Het
Piwil2 T A 14: 70,632,890 (GRCm39) I561F probably benign Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Ppp4r4 A G 12: 103,564,407 (GRCm39) T591A probably benign Het
Prxl2c T C 13: 64,460,092 (GRCm39) S84G probably benign Het
Ptprb A G 10: 116,151,156 (GRCm39) T273A probably benign Het
Ptpro T A 6: 137,393,861 (GRCm39) L843* probably null Het
Qrfpr T C 3: 36,243,751 (GRCm39) I117V probably benign Het
Qrich2 T C 11: 116,346,591 (GRCm39) D1411G probably benign Het
Rad51ap2 T C 12: 11,506,656 (GRCm39) S193P probably benign Het
Raver1 T C 9: 20,992,610 (GRCm39) E273G probably benign Het
Rubcn C A 16: 32,688,644 (GRCm39) probably benign Het
S1pr4 C T 10: 81,334,326 (GRCm39) V383I possibly damaging Het
Scn7a T C 2: 66,506,494 (GRCm39) D1465G probably damaging Het
Smarca4 T A 9: 21,558,655 (GRCm39) D607E possibly damaging Het
Srbd1 T A 17: 86,292,882 (GRCm39) I896L possibly damaging Het
Sulf2 G T 2: 165,921,456 (GRCm39) N722K possibly damaging Het
Surf1 A G 2: 26,806,280 (GRCm39) Y22H probably benign Het
Syngr2 A G 11: 117,703,982 (GRCm39) T150A probably benign Het
Szt2 G T 4: 118,223,416 (GRCm39) H3056N unknown Het
Tmf1 A T 6: 97,138,372 (GRCm39) S849T probably benign Het
Tns1 T A 1: 74,130,490 (GRCm39) probably benign Het
Trio G T 15: 27,774,172 (GRCm39) P1764Q probably damaging Het
Trpc3 A T 3: 36,694,821 (GRCm39) V711D probably damaging Het
Ttll3 G T 6: 113,386,298 (GRCm39) K710N probably damaging Het
Unc13c A G 9: 73,388,391 (GRCm39) S2132P possibly damaging Het
Utp20 G A 10: 88,636,998 (GRCm39) P738S possibly damaging Het
Vmn2r76 C T 7: 85,877,892 (GRCm39) V502I probably benign Het
Vsig1 C T X: 139,833,875 (GRCm39) H232Y probably benign Het
Wdr64 T G 1: 175,591,511 (GRCm39) F390V probably damaging Het
Ybx3 T G 6: 131,344,826 (GRCm39) T341P possibly damaging Het
Zdhhc11 C A 13: 74,121,866 (GRCm39) Q126K possibly damaging Het
Zfp777 G A 6: 48,002,072 (GRCm39) P673S probably damaging Het
Other mutations in Eps8l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Eps8l1 APN 7 4,481,919 (GRCm39) utr 3 prime probably benign
IGL01455:Eps8l1 APN 7 4,481,922 (GRCm39) utr 3 prime probably benign
IGL01872:Eps8l1 APN 7 4,475,295 (GRCm39) splice site probably benign
IGL02343:Eps8l1 APN 7 4,475,123 (GRCm39) missense probably benign 0.04
IGL02585:Eps8l1 APN 7 4,472,212 (GRCm39) missense probably damaging 1.00
IGL02596:Eps8l1 APN 7 4,473,871 (GRCm39) missense probably damaging 0.99
IGL02673:Eps8l1 APN 7 4,481,731 (GRCm39) missense probably damaging 1.00
IGL03117:Eps8l1 APN 7 4,473,886 (GRCm39) missense probably damaging 1.00
Anamnestic UTSW 7 4,473,873 (GRCm39) missense probably damaging 0.98
souvenir UTSW 7 4,480,895 (GRCm39) missense possibly damaging 0.56
PIT4142001:Eps8l1 UTSW 7 4,474,414 (GRCm39) missense probably benign 0.00
PIT4151001:Eps8l1 UTSW 7 4,474,414 (GRCm39) missense probably benign 0.00
PIT4480001:Eps8l1 UTSW 7 4,474,414 (GRCm39) missense probably benign 0.00
R0015:Eps8l1 UTSW 7 4,480,556 (GRCm39) splice site probably benign
R0599:Eps8l1 UTSW 7 4,480,956 (GRCm39) missense possibly damaging 0.90
R0686:Eps8l1 UTSW 7 4,480,449 (GRCm39) missense probably benign 0.36
R0827:Eps8l1 UTSW 7 4,480,388 (GRCm39) missense possibly damaging 0.86
R1015:Eps8l1 UTSW 7 4,472,932 (GRCm39) missense probably damaging 1.00
R1447:Eps8l1 UTSW 7 4,477,055 (GRCm39) missense probably damaging 1.00
R1490:Eps8l1 UTSW 7 4,473,888 (GRCm39) missense probably damaging 1.00
R1527:Eps8l1 UTSW 7 4,474,393 (GRCm39) missense probably benign
R1553:Eps8l1 UTSW 7 4,480,448 (GRCm39) missense probably damaging 0.98
R1763:Eps8l1 UTSW 7 4,474,822 (GRCm39) missense probably benign 0.43
R1863:Eps8l1 UTSW 7 4,468,359 (GRCm39) utr 5 prime probably benign
R2357:Eps8l1 UTSW 7 4,473,354 (GRCm39) missense probably benign 0.06
R3153:Eps8l1 UTSW 7 4,474,798 (GRCm39) missense probably damaging 1.00
R4082:Eps8l1 UTSW 7 4,473,797 (GRCm39) splice site probably null
R4539:Eps8l1 UTSW 7 4,481,623 (GRCm39) missense probably damaging 1.00
R4684:Eps8l1 UTSW 7 4,476,944 (GRCm39) missense probably damaging 0.99
R4930:Eps8l1 UTSW 7 4,463,915 (GRCm39) missense possibly damaging 0.66
R4931:Eps8l1 UTSW 7 4,474,240 (GRCm39) missense possibly damaging 0.95
R5245:Eps8l1 UTSW 7 4,473,873 (GRCm39) missense probably damaging 0.98
R5247:Eps8l1 UTSW 7 4,473,401 (GRCm39) missense probably damaging 1.00
R5305:Eps8l1 UTSW 7 4,480,895 (GRCm39) missense possibly damaging 0.56
R5420:Eps8l1 UTSW 7 4,473,160 (GRCm39) splice site probably null
R5620:Eps8l1 UTSW 7 4,463,945 (GRCm39) missense possibly damaging 0.83
R5705:Eps8l1 UTSW 7 4,473,034 (GRCm39) missense probably benign 0.00
R6063:Eps8l1 UTSW 7 4,474,296 (GRCm39) missense possibly damaging 0.56
R6909:Eps8l1 UTSW 7 4,472,899 (GRCm39) nonsense probably null
R7096:Eps8l1 UTSW 7 4,477,190 (GRCm39) missense probably benign 0.01
R7136:Eps8l1 UTSW 7 4,480,403 (GRCm39) missense probably damaging 1.00
R7144:Eps8l1 UTSW 7 4,475,184 (GRCm39) missense probably damaging 1.00
R7381:Eps8l1 UTSW 7 4,473,437 (GRCm39) splice site probably null
R7539:Eps8l1 UTSW 7 4,473,036 (GRCm39) missense probably damaging 1.00
R7784:Eps8l1 UTSW 7 4,475,121 (GRCm39) missense probably damaging 1.00
R8190:Eps8l1 UTSW 7 4,474,297 (GRCm39) missense probably benign 0.05
R8311:Eps8l1 UTSW 7 4,474,817 (GRCm39) missense probably damaging 1.00
R8549:Eps8l1 UTSW 7 4,473,853 (GRCm39) missense probably damaging 1.00
R8960:Eps8l1 UTSW 7 4,481,214 (GRCm39) missense probably damaging 1.00
R8974:Eps8l1 UTSW 7 4,474,817 (GRCm39) missense probably damaging 1.00
R9003:Eps8l1 UTSW 7 4,464,016 (GRCm39) missense possibly damaging 0.92
R9023:Eps8l1 UTSW 7 4,477,042 (GRCm39) nonsense probably null
R9131:Eps8l1 UTSW 7 4,480,573 (GRCm39) missense
R9517:Eps8l1 UTSW 7 4,480,636 (GRCm39) missense probably damaging 1.00
R9653:Eps8l1 UTSW 7 4,481,886 (GRCm39) missense unknown
X0060:Eps8l1 UTSW 7 4,473,850 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGTGCGATGTAGCGGTCAC -3'
(R):5'- GGTTCCTTAGACCCTGATGC -3'

Sequencing Primer
(F):5'- CCTCCTGACTGCTGGAATTAAAGG -3'
(R):5'- CTTAGACCCTGATGCTAGCTAG -3'
Posted On 2019-12-20