Incidental Mutation 'R7833:Smarca4'
ID 605783
Institutional Source Beutler Lab
Gene Symbol Smarca4
Ensembl Gene ENSMUSG00000032187
Gene Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Synonyms SW1/SNF, Brg1, SNF2beta, b2b692Clo, b2b508.1Clo
MMRRC Submission 045887-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7833 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 21527465-21615526 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21558655 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 607 (D607E)
Ref Sequence ENSEMBL: ENSMUSP00000096547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034707] [ENSMUST00000098948] [ENSMUST00000174008]
AlphaFold Q3TKT4
Predicted Effect probably damaging
Transcript: ENSMUST00000034707
AA Change: D607E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034707
Gene: ENSMUSG00000032187
AA Change: D607E

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1360 1385 N/A INTRINSIC
low complexity region 1388 1398 N/A INTRINSIC
BROMO 1422 1533 4.19e-42 SMART
low complexity region 1534 1557 N/A INTRINSIC
low complexity region 1578 1588 N/A INTRINSIC
low complexity region 1594 1614 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098948
AA Change: D607E

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096547
Gene: ENSMUSG00000032187
AA Change: D607E

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1363 1388 N/A INTRINSIC
low complexity region 1391 1401 N/A INTRINSIC
BROMO 1425 1536 4.19e-42 SMART
low complexity region 1537 1560 N/A INTRINSIC
low complexity region 1581 1591 N/A INTRINSIC
low complexity region 1597 1617 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000133535
Gene: ENSMUSG00000032187
AA Change: D411E

DomainStartEndE-ValueType
low complexity region 26 52 N/A INTRINSIC
low complexity region 57 94 N/A INTRINSIC
low complexity region 109 135 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
HSA 265 337 2e-27 SMART
coiled coil region 367 399 N/A INTRINSIC
BRK 417 461 5.17e-21 SMART
low complexity region 462 477 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
DEXDc 555 747 5.17e-38 SMART
Blast:DEXDc 758 790 6e-10 BLAST
low complexity region 824 839 N/A INTRINSIC
HELICc 915 999 7.27e-24 SMART
low complexity region 1088 1105 N/A INTRINSIC
SnAC 1126 1194 2.8e-29 SMART
low complexity region 1201 1226 N/A INTRINSIC
low complexity region 1229 1239 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174008
AA Change: D607E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133922
Gene: ENSMUSG00000032187
AA Change: D607E

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1360 1385 N/A INTRINSIC
low complexity region 1388 1398 N/A INTRINSIC
BROMO 1422 1532 1.36e-41 SMART
low complexity region 1533 1556 N/A INTRINSIC
low complexity region 1577 1587 N/A INTRINSIC
low complexity region 1593 1613 N/A INTRINSIC
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. In addition, this protein can bind BRCA1, as well as regulate the expression of the tumorigenic protein CD44. Mutations in this gene cause rhabdoid tumor predisposition syndrome type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a null allele die in utero before implantation. Embryos heterozygous for this null allele and an ENU-induced allele show impaired definitive erythropoiesis, anemia and lethality during organogenesis. Heterozygotes for a different null allele show cyanosis and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,902,059 (GRCm39) S578T possibly damaging Het
Acot5 A G 12: 84,122,601 (GRCm39) Q395R probably damaging Het
Adamts15 T A 9: 30,833,401 (GRCm39) T45S probably benign Het
Agbl2 A G 2: 90,645,777 (GRCm39) K837E probably benign Het
Atf2 T C 2: 73,684,229 (GRCm39) T19A possibly damaging Het
Atp6v0a2 T C 5: 124,782,969 (GRCm39) V238A probably damaging Het
Atp9a A T 2: 168,516,777 (GRCm39) V430E probably benign Het
Cachd1 G A 4: 100,832,012 (GRCm39) V725I probably benign Het
Ccnb1 G A 13: 100,917,859 (GRCm39) T247M probably damaging Het
Cd40 A T 2: 164,908,431 (GRCm39) D169V probably benign Het
Cdc25c G A 18: 34,880,296 (GRCm39) T146I probably benign Het
Cdhr18 A T 14: 13,896,968 (GRCm38) probably null Het
Ceacam3 C A 7: 16,893,778 (GRCm39) Q430K Het
Cerkl G A 2: 79,171,724 (GRCm39) T378I probably benign Het
Cpn2 G T 16: 30,079,163 (GRCm39) N179K probably damaging Het
Duox1 A G 2: 122,154,869 (GRCm39) D418G probably damaging Het
Eif1ad13 G A 12: 87,762,322 (GRCm39) R14K unknown Het
Eps8l1 C A 7: 4,471,866 (GRCm39) P11T possibly damaging Het
Erc1 C T 6: 119,801,447 (GRCm39) W190* probably null Het
Exosc7 A T 9: 122,959,984 (GRCm39) E195V probably benign Het
F2rl2 A G 13: 95,837,426 (GRCm39) N157S probably damaging Het
Fgd2 T C 17: 29,586,369 (GRCm39) L270P possibly damaging Het
Fitm2 A T 2: 163,312,019 (GRCm39) W65R probably damaging Het
Gabbr1 T G 17: 37,367,861 (GRCm39) I437S possibly damaging Het
Galntl6 A T 8: 58,310,571 (GRCm39) S377T probably benign Het
Gml2 T A 15: 74,693,217 (GRCm39) C73* probably null Het
Htr6 G T 4: 138,789,142 (GRCm39) F304L probably damaging Het
Hydin G A 8: 111,316,092 (GRCm39) G4328D probably damaging Het
Kcnj14 T C 7: 45,467,317 (GRCm39) D343G probably damaging Het
Klhdc1 T A 12: 69,329,942 (GRCm39) I357N probably benign Het
Lcor A G 19: 41,573,024 (GRCm39) D593G probably benign Het
Man2a1 A G 17: 64,973,746 (GRCm39) T341A probably damaging Het
Mrm1 A C 11: 84,709,469 (GRCm39) V196G probably damaging Het
Mybbp1a A G 11: 72,333,727 (GRCm39) probably null Het
Myo19 G A 11: 84,800,093 (GRCm39) C826Y probably benign Het
Nbea A G 3: 55,910,218 (GRCm39) W1326R probably damaging Het
Notch1 A G 2: 26,349,545 (GRCm39) *2532Q probably null Het
Npas2 A G 1: 39,365,228 (GRCm39) Y287C probably damaging Het
Or3a1b G A 11: 74,012,663 (GRCm39) D183N probably damaging Het
Or9g20 T A 2: 85,630,293 (GRCm39) D107V probably benign Het
Pate7 T A 9: 35,688,406 (GRCm39) S60C probably damaging Het
Pcdhga7 C A 18: 37,849,077 (GRCm39) D361E possibly damaging Het
Pde10a T A 17: 9,180,752 (GRCm39) Y447N possibly damaging Het
Piwil2 T A 14: 70,632,890 (GRCm39) I561F probably benign Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Ppp4r4 A G 12: 103,564,407 (GRCm39) T591A probably benign Het
Prxl2c T C 13: 64,460,092 (GRCm39) S84G probably benign Het
Ptprb A G 10: 116,151,156 (GRCm39) T273A probably benign Het
Ptpro T A 6: 137,393,861 (GRCm39) L843* probably null Het
Qrfpr T C 3: 36,243,751 (GRCm39) I117V probably benign Het
Qrich2 T C 11: 116,346,591 (GRCm39) D1411G probably benign Het
Rad51ap2 T C 12: 11,506,656 (GRCm39) S193P probably benign Het
Raver1 T C 9: 20,992,610 (GRCm39) E273G probably benign Het
Rubcn C A 16: 32,688,644 (GRCm39) probably benign Het
S1pr4 C T 10: 81,334,326 (GRCm39) V383I possibly damaging Het
Scn7a T C 2: 66,506,494 (GRCm39) D1465G probably damaging Het
Srbd1 T A 17: 86,292,882 (GRCm39) I896L possibly damaging Het
Sulf2 G T 2: 165,921,456 (GRCm39) N722K possibly damaging Het
Surf1 A G 2: 26,806,280 (GRCm39) Y22H probably benign Het
Syngr2 A G 11: 117,703,982 (GRCm39) T150A probably benign Het
Szt2 G T 4: 118,223,416 (GRCm39) H3056N unknown Het
Tmf1 A T 6: 97,138,372 (GRCm39) S849T probably benign Het
Tns1 T A 1: 74,130,490 (GRCm39) probably benign Het
Trio G T 15: 27,774,172 (GRCm39) P1764Q probably damaging Het
Trpc3 A T 3: 36,694,821 (GRCm39) V711D probably damaging Het
Ttll3 G T 6: 113,386,298 (GRCm39) K710N probably damaging Het
Unc13c A G 9: 73,388,391 (GRCm39) S2132P possibly damaging Het
Utp20 G A 10: 88,636,998 (GRCm39) P738S possibly damaging Het
Vmn2r76 C T 7: 85,877,892 (GRCm39) V502I probably benign Het
Vsig1 C T X: 139,833,875 (GRCm39) H232Y probably benign Het
Wdr64 T G 1: 175,591,511 (GRCm39) F390V probably damaging Het
Ybx3 T G 6: 131,344,826 (GRCm39) T341P possibly damaging Het
Zdhhc11 C A 13: 74,121,866 (GRCm39) Q126K possibly damaging Het
Zfp777 G A 6: 48,002,072 (GRCm39) P673S probably damaging Het
Other mutations in Smarca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Smarca4 APN 9 21,590,369 (GRCm39) missense probably benign 0.30
IGL01694:Smarca4 APN 9 21,577,166 (GRCm39) missense probably damaging 1.00
IGL02147:Smarca4 APN 9 21,546,999 (GRCm39) missense probably damaging 0.98
IGL02417:Smarca4 APN 9 21,612,386 (GRCm39) missense probably damaging 1.00
IGL02421:Smarca4 APN 9 21,550,535 (GRCm39) missense probably damaging 1.00
IGL02550:Smarca4 APN 9 21,597,418 (GRCm39) missense probably benign 0.25
IGL02794:Smarca4 APN 9 21,584,638 (GRCm39) splice site probably benign
IGL03030:Smarca4 APN 9 21,547,132 (GRCm39) missense probably benign 0.14
IGL03037:Smarca4 APN 9 21,544,231 (GRCm39) unclassified probably benign
IGL03069:Smarca4 APN 9 21,547,132 (GRCm39) missense probably benign 0.14
IGL03355:Smarca4 APN 9 21,547,132 (GRCm39) missense probably benign 0.14
R0123:Smarca4 UTSW 9 21,548,620 (GRCm39) missense probably damaging 1.00
R0134:Smarca4 UTSW 9 21,548,620 (GRCm39) missense probably damaging 1.00
R0230:Smarca4 UTSW 9 21,612,168 (GRCm39) missense probably damaging 0.99
R0269:Smarca4 UTSW 9 21,547,497 (GRCm39) missense probably benign 0.09
R0631:Smarca4 UTSW 9 21,570,280 (GRCm39) splice site probably benign
R0665:Smarca4 UTSW 9 21,612,239 (GRCm39) small deletion probably benign
R0726:Smarca4 UTSW 9 21,611,435 (GRCm39) critical splice donor site probably null
R0801:Smarca4 UTSW 9 21,553,850 (GRCm39) missense possibly damaging 0.81
R0918:Smarca4 UTSW 9 21,547,511 (GRCm39) missense probably benign 0.16
R1411:Smarca4 UTSW 9 21,570,251 (GRCm39) missense probably damaging 1.00
R1604:Smarca4 UTSW 9 21,612,239 (GRCm39) small deletion probably benign
R1768:Smarca4 UTSW 9 21,612,479 (GRCm39) missense possibly damaging 0.56
R2004:Smarca4 UTSW 9 21,588,776 (GRCm39) missense probably damaging 1.00
R2031:Smarca4 UTSW 9 21,597,358 (GRCm39) missense possibly damaging 0.68
R2211:Smarca4 UTSW 9 21,597,325 (GRCm39) missense probably damaging 1.00
R2512:Smarca4 UTSW 9 21,546,994 (GRCm39) missense possibly damaging 0.95
R2875:Smarca4 UTSW 9 21,553,876 (GRCm39) missense possibly damaging 0.55
R3786:Smarca4 UTSW 9 21,583,355 (GRCm39) missense possibly damaging 0.94
R4829:Smarca4 UTSW 9 21,550,623 (GRCm39) missense probably damaging 0.97
R5084:Smarca4 UTSW 9 21,572,059 (GRCm39) missense probably damaging 1.00
R5222:Smarca4 UTSW 9 21,567,002 (GRCm39) missense probably benign 0.01
R5785:Smarca4 UTSW 9 21,597,322 (GRCm39) missense probably damaging 0.99
R5844:Smarca4 UTSW 9 21,589,238 (GRCm39) intron probably benign
R5964:Smarca4 UTSW 9 21,558,726 (GRCm39) missense probably benign 0.00
R6001:Smarca4 UTSW 9 21,544,205 (GRCm39) unclassified probably benign
R6072:Smarca4 UTSW 9 21,611,417 (GRCm39) missense probably damaging 1.00
R6254:Smarca4 UTSW 9 21,611,173 (GRCm39) missense probably damaging 1.00
R6320:Smarca4 UTSW 9 21,548,671 (GRCm39) missense probably damaging 1.00
R6353:Smarca4 UTSW 9 21,590,445 (GRCm39) critical splice donor site probably null
R6461:Smarca4 UTSW 9 21,590,316 (GRCm39) missense probably damaging 1.00
R6886:Smarca4 UTSW 9 21,570,127 (GRCm39) missense probably damaging 1.00
R7098:Smarca4 UTSW 9 21,546,116 (GRCm39) missense probably benign 0.10
R7253:Smarca4 UTSW 9 21,570,256 (GRCm39) missense probably benign 0.01
R7307:Smarca4 UTSW 9 21,550,096 (GRCm39) missense probably damaging 1.00
R7382:Smarca4 UTSW 9 21,570,229 (GRCm39) missense probably damaging 0.98
R7445:Smarca4 UTSW 9 21,597,543 (GRCm39) missense probably damaging 1.00
R7535:Smarca4 UTSW 9 21,558,921 (GRCm39) missense possibly damaging 0.82
R7573:Smarca4 UTSW 9 21,550,371 (GRCm39) splice site probably null
R7644:Smarca4 UTSW 9 21,566,950 (GRCm39) missense probably benign 0.00
R7734:Smarca4 UTSW 9 21,578,658 (GRCm39) missense possibly damaging 0.65
R8085:Smarca4 UTSW 9 21,570,108 (GRCm39) splice site probably null
R8119:Smarca4 UTSW 9 21,558,922 (GRCm39) missense possibly damaging 0.61
R8320:Smarca4 UTSW 9 21,588,798 (GRCm39) missense probably benign 0.10
R8445:Smarca4 UTSW 9 21,612,239 (GRCm39) small deletion probably benign
R8493:Smarca4 UTSW 9 21,570,144 (GRCm39) missense probably damaging 1.00
R8748:Smarca4 UTSW 9 21,546,164 (GRCm39) missense possibly damaging 0.85
R8788:Smarca4 UTSW 9 21,550,024 (GRCm39) missense probably damaging 1.00
R8817:Smarca4 UTSW 9 21,547,497 (GRCm39) missense probably benign 0.04
R9241:Smarca4 UTSW 9 21,550,604 (GRCm39) missense possibly damaging 0.72
R9446:Smarca4 UTSW 9 21,547,155 (GRCm39) missense unknown
R9570:Smarca4 UTSW 9 21,580,849 (GRCm39) missense probably damaging 1.00
R9727:Smarca4 UTSW 9 21,611,160 (GRCm39) missense probably damaging 1.00
R9801:Smarca4 UTSW 9 21,586,397 (GRCm39) missense probably damaging 1.00
Z1176:Smarca4 UTSW 9 21,614,253 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAAATTATCAGGCCTCAGTCC -3'
(R):5'- GCAAGTAGCAGCTTTACTTTCC -3'

Sequencing Primer
(F):5'- AGTCCTTTTTACCTTCAGAGTGATG -3'
(R):5'- TGATCTGGCCCTCAAATGCAAG -3'
Posted On 2019-12-20