Incidental Mutation 'R7833:Adamts15'
ID 605784
Institutional Source Beutler Lab
Gene Symbol Adamts15
Ensembl Gene ENSMUSG00000033453
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 15
Synonyms
MMRRC Submission 045887-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7833 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 30810451-30833748 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30833401 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 45 (T45S)
Ref Sequence ENSEMBL: ENSMUSP00000067022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065112] [ENSMUST00000216215]
AlphaFold P59384
Predicted Effect probably benign
Transcript: ENSMUST00000065112
AA Change: T45S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067022
Gene: ENSMUSG00000033453
AA Change: T45S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Pep_M12B_propep 24 157 8.7e-27 PFAM
Pfam:Reprolysin_4 216 422 8.2e-7 PFAM
Pfam:Reprolysin_5 217 404 7.2e-13 PFAM
Pfam:Reprolysin 218 427 3.7e-20 PFAM
Pfam:Reprolysin_3 240 372 6.1e-10 PFAM
Blast:ACR 429 507 1e-25 BLAST
TSP1 519 571 7.85e-12 SMART
Pfam:ADAM_spacer1 683 801 7.1e-36 PFAM
TSP1 842 895 3e-8 SMART
TSP1 896 949 4.21e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216215
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active versicanase enzyme. This gene is located adjacent to a related ADAMTS gene (Adamts8) on chromosome 9. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,902,059 (GRCm39) S578T possibly damaging Het
Acot5 A G 12: 84,122,601 (GRCm39) Q395R probably damaging Het
Agbl2 A G 2: 90,645,777 (GRCm39) K837E probably benign Het
Atf2 T C 2: 73,684,229 (GRCm39) T19A possibly damaging Het
Atp6v0a2 T C 5: 124,782,969 (GRCm39) V238A probably damaging Het
Atp9a A T 2: 168,516,777 (GRCm39) V430E probably benign Het
Cachd1 G A 4: 100,832,012 (GRCm39) V725I probably benign Het
Ccnb1 G A 13: 100,917,859 (GRCm39) T247M probably damaging Het
Cd40 A T 2: 164,908,431 (GRCm39) D169V probably benign Het
Cdc25c G A 18: 34,880,296 (GRCm39) T146I probably benign Het
Cdhr18 A T 14: 13,896,968 (GRCm38) probably null Het
Ceacam3 C A 7: 16,893,778 (GRCm39) Q430K Het
Cerkl G A 2: 79,171,724 (GRCm39) T378I probably benign Het
Cpn2 G T 16: 30,079,163 (GRCm39) N179K probably damaging Het
Duox1 A G 2: 122,154,869 (GRCm39) D418G probably damaging Het
Eif1ad13 G A 12: 87,762,322 (GRCm39) R14K unknown Het
Eps8l1 C A 7: 4,471,866 (GRCm39) P11T possibly damaging Het
Erc1 C T 6: 119,801,447 (GRCm39) W190* probably null Het
Exosc7 A T 9: 122,959,984 (GRCm39) E195V probably benign Het
F2rl2 A G 13: 95,837,426 (GRCm39) N157S probably damaging Het
Fgd2 T C 17: 29,586,369 (GRCm39) L270P possibly damaging Het
Fitm2 A T 2: 163,312,019 (GRCm39) W65R probably damaging Het
Gabbr1 T G 17: 37,367,861 (GRCm39) I437S possibly damaging Het
Galntl6 A T 8: 58,310,571 (GRCm39) S377T probably benign Het
Gml2 T A 15: 74,693,217 (GRCm39) C73* probably null Het
Htr6 G T 4: 138,789,142 (GRCm39) F304L probably damaging Het
Hydin G A 8: 111,316,092 (GRCm39) G4328D probably damaging Het
Kcnj14 T C 7: 45,467,317 (GRCm39) D343G probably damaging Het
Klhdc1 T A 12: 69,329,942 (GRCm39) I357N probably benign Het
Lcor A G 19: 41,573,024 (GRCm39) D593G probably benign Het
Man2a1 A G 17: 64,973,746 (GRCm39) T341A probably damaging Het
Mrm1 A C 11: 84,709,469 (GRCm39) V196G probably damaging Het
Mybbp1a A G 11: 72,333,727 (GRCm39) probably null Het
Myo19 G A 11: 84,800,093 (GRCm39) C826Y probably benign Het
Nbea A G 3: 55,910,218 (GRCm39) W1326R probably damaging Het
Notch1 A G 2: 26,349,545 (GRCm39) *2532Q probably null Het
Npas2 A G 1: 39,365,228 (GRCm39) Y287C probably damaging Het
Or3a1b G A 11: 74,012,663 (GRCm39) D183N probably damaging Het
Or9g20 T A 2: 85,630,293 (GRCm39) D107V probably benign Het
Pate7 T A 9: 35,688,406 (GRCm39) S60C probably damaging Het
Pcdhga7 C A 18: 37,849,077 (GRCm39) D361E possibly damaging Het
Pde10a T A 17: 9,180,752 (GRCm39) Y447N possibly damaging Het
Piwil2 T A 14: 70,632,890 (GRCm39) I561F probably benign Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Ppp4r4 A G 12: 103,564,407 (GRCm39) T591A probably benign Het
Prxl2c T C 13: 64,460,092 (GRCm39) S84G probably benign Het
Ptprb A G 10: 116,151,156 (GRCm39) T273A probably benign Het
Ptpro T A 6: 137,393,861 (GRCm39) L843* probably null Het
Qrfpr T C 3: 36,243,751 (GRCm39) I117V probably benign Het
Qrich2 T C 11: 116,346,591 (GRCm39) D1411G probably benign Het
Rad51ap2 T C 12: 11,506,656 (GRCm39) S193P probably benign Het
Raver1 T C 9: 20,992,610 (GRCm39) E273G probably benign Het
Rubcn C A 16: 32,688,644 (GRCm39) probably benign Het
S1pr4 C T 10: 81,334,326 (GRCm39) V383I possibly damaging Het
Scn7a T C 2: 66,506,494 (GRCm39) D1465G probably damaging Het
Smarca4 T A 9: 21,558,655 (GRCm39) D607E possibly damaging Het
Srbd1 T A 17: 86,292,882 (GRCm39) I896L possibly damaging Het
Sulf2 G T 2: 165,921,456 (GRCm39) N722K possibly damaging Het
Surf1 A G 2: 26,806,280 (GRCm39) Y22H probably benign Het
Syngr2 A G 11: 117,703,982 (GRCm39) T150A probably benign Het
Szt2 G T 4: 118,223,416 (GRCm39) H3056N unknown Het
Tmf1 A T 6: 97,138,372 (GRCm39) S849T probably benign Het
Tns1 T A 1: 74,130,490 (GRCm39) probably benign Het
Trio G T 15: 27,774,172 (GRCm39) P1764Q probably damaging Het
Trpc3 A T 3: 36,694,821 (GRCm39) V711D probably damaging Het
Ttll3 G T 6: 113,386,298 (GRCm39) K710N probably damaging Het
Unc13c A G 9: 73,388,391 (GRCm39) S2132P possibly damaging Het
Utp20 G A 10: 88,636,998 (GRCm39) P738S possibly damaging Het
Vmn2r76 C T 7: 85,877,892 (GRCm39) V502I probably benign Het
Vsig1 C T X: 139,833,875 (GRCm39) H232Y probably benign Het
Wdr64 T G 1: 175,591,511 (GRCm39) F390V probably damaging Het
Ybx3 T G 6: 131,344,826 (GRCm39) T341P possibly damaging Het
Zdhhc11 C A 13: 74,121,866 (GRCm39) Q126K possibly damaging Het
Zfp777 G A 6: 48,002,072 (GRCm39) P673S probably damaging Het
Other mutations in Adamts15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Adamts15 APN 9 30,813,349 (GRCm39) missense probably damaging 1.00
IGL01325:Adamts15 APN 9 30,832,984 (GRCm39) missense possibly damaging 0.86
IGL01506:Adamts15 APN 9 30,833,430 (GRCm39) missense probably benign 0.08
IGL01897:Adamts15 APN 9 30,813,448 (GRCm39) missense probably damaging 1.00
IGL02137:Adamts15 APN 9 30,821,956 (GRCm39) missense probably damaging 1.00
IGL02876:Adamts15 APN 9 30,815,818 (GRCm39) missense probably damaging 0.98
IGL02997:Adamts15 APN 9 30,817,353 (GRCm39) splice site probably benign
IGL03094:Adamts15 APN 9 30,815,768 (GRCm39) splice site probably benign
IGL03146:Adamts15 APN 9 30,832,863 (GRCm39) missense probably damaging 0.99
IGL03241:Adamts15 APN 9 30,815,781 (GRCm39) missense probably damaging 1.00
Awareness UTSW 9 30,822,404 (GRCm39) critical splice donor site probably null
heightened UTSW 9 30,816,066 (GRCm39) missense probably damaging 1.00
Pugsley UTSW 9 30,817,454 (GRCm39) missense probably damaging 1.00
sparticus UTSW 9 30,821,898 (GRCm39) missense probably benign 0.40
R0118:Adamts15 UTSW 9 30,823,040 (GRCm39) missense probably damaging 1.00
R0635:Adamts15 UTSW 9 30,816,066 (GRCm39) missense probably damaging 1.00
R0827:Adamts15 UTSW 9 30,832,776 (GRCm39) missense probably damaging 1.00
R0946:Adamts15 UTSW 9 30,813,493 (GRCm39) missense probably damaging 1.00
R1608:Adamts15 UTSW 9 30,813,775 (GRCm39) missense probably damaging 0.99
R1806:Adamts15 UTSW 9 30,816,111 (GRCm39) missense probably damaging 1.00
R1954:Adamts15 UTSW 9 30,822,004 (GRCm39) missense probably benign
R1967:Adamts15 UTSW 9 30,832,605 (GRCm39) nonsense probably null
R2009:Adamts15 UTSW 9 30,833,433 (GRCm39) missense probably benign 0.17
R2129:Adamts15 UTSW 9 30,815,799 (GRCm39) missense probably benign 0.05
R2329:Adamts15 UTSW 9 30,813,781 (GRCm39) missense probably damaging 1.00
R2991:Adamts15 UTSW 9 30,832,690 (GRCm39) missense probably benign
R3970:Adamts15 UTSW 9 30,821,898 (GRCm39) missense probably benign 0.40
R4212:Adamts15 UTSW 9 30,817,470 (GRCm39) missense probably damaging 0.99
R4326:Adamts15 UTSW 9 30,815,814 (GRCm39) missense probably benign
R4329:Adamts15 UTSW 9 30,815,814 (GRCm39) missense probably benign
R4594:Adamts15 UTSW 9 30,832,743 (GRCm39) missense probably damaging 0.99
R5110:Adamts15 UTSW 9 30,832,740 (GRCm39) missense probably benign 0.01
R5120:Adamts15 UTSW 9 30,832,872 (GRCm39) missense probably damaging 1.00
R5697:Adamts15 UTSW 9 30,823,090 (GRCm39) missense probably damaging 1.00
R5901:Adamts15 UTSW 9 30,813,786 (GRCm39) missense probably damaging 1.00
R6011:Adamts15 UTSW 9 30,814,082 (GRCm39) missense probably damaging 0.98
R6020:Adamts15 UTSW 9 30,813,358 (GRCm39) missense probably benign 0.03
R6651:Adamts15 UTSW 9 30,833,448 (GRCm39) missense probably damaging 0.98
R6665:Adamts15 UTSW 9 30,815,775 (GRCm39) critical splice donor site probably null
R7021:Adamts15 UTSW 9 30,832,776 (GRCm39) missense probably damaging 1.00
R7231:Adamts15 UTSW 9 30,817,454 (GRCm39) missense probably damaging 1.00
R7290:Adamts15 UTSW 9 30,813,906 (GRCm39) missense probably benign 0.05
R7390:Adamts15 UTSW 9 30,822,404 (GRCm39) critical splice donor site probably null
R7798:Adamts15 UTSW 9 30,815,939 (GRCm39) missense probably damaging 1.00
R7908:Adamts15 UTSW 9 30,813,522 (GRCm39) missense probably benign
R8175:Adamts15 UTSW 9 30,815,952 (GRCm39) missense probably damaging 1.00
R8177:Adamts15 UTSW 9 30,833,322 (GRCm39) missense probably damaging 1.00
R8347:Adamts15 UTSW 9 30,813,846 (GRCm39) missense probably benign 0.07
R8348:Adamts15 UTSW 9 30,813,846 (GRCm39) missense probably benign 0.07
R8374:Adamts15 UTSW 9 30,814,002 (GRCm39) missense probably benign 0.21
R8473:Adamts15 UTSW 9 30,816,085 (GRCm39) missense probably damaging 1.00
R8680:Adamts15 UTSW 9 30,823,055 (GRCm39) missense possibly damaging 0.57
R9113:Adamts15 UTSW 9 30,822,498 (GRCm39) missense probably damaging 1.00
R9336:Adamts15 UTSW 9 30,816,085 (GRCm39) missense probably damaging 1.00
R9381:Adamts15 UTSW 9 30,813,816 (GRCm39) missense probably damaging 0.99
X0063:Adamts15 UTSW 9 30,833,526 (GRCm39) missense possibly damaging 0.96
X0067:Adamts15 UTSW 9 30,832,878 (GRCm39) missense probably damaging 1.00
Z1176:Adamts15 UTSW 9 30,821,996 (GRCm39) missense probably damaging 1.00
Z1177:Adamts15 UTSW 9 30,813,787 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTCACATACCCGGAATAGAAG -3'
(R):5'- TACAAGGGGACAGTGCTTGC -3'

Sequencing Primer
(F):5'- TACCCGGAATAGAAGCAGCGTC -3'
(R):5'- AGCCGGGCTAAGTCCCATC -3'
Posted On 2019-12-20