Incidental Mutation 'R7833:Unc13c'
ID 605787
Institutional Source Beutler Lab
Gene Symbol Unc13c
Ensembl Gene ENSMUSG00000062151
Gene Name unc-13 homolog C
Synonyms D9Ertd414e, 1500037O19Rik, Munc13-3, Unc13h3
MMRRC Submission 045887-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7833 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 73386704-73876248 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73388391 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 2132 (S2132P)
Ref Sequence ENSEMBL: ENSMUSP00000074726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]
AlphaFold Q8K0T7
Predicted Effect possibly damaging
Transcript: ENSMUST00000075245
AA Change: S2132P

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151
AA Change: S2132P

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1883 2023 2.6e-50 PFAM
C2 2058 2164 4.15e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184666
AA Change: S2132P

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151
AA Change: S2132P

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1882 2024 8.3e-59 PFAM
C2 2058 2164 4.15e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,902,059 (GRCm39) S578T possibly damaging Het
Acot5 A G 12: 84,122,601 (GRCm39) Q395R probably damaging Het
Adamts15 T A 9: 30,833,401 (GRCm39) T45S probably benign Het
Agbl2 A G 2: 90,645,777 (GRCm39) K837E probably benign Het
Atf2 T C 2: 73,684,229 (GRCm39) T19A possibly damaging Het
Atp6v0a2 T C 5: 124,782,969 (GRCm39) V238A probably damaging Het
Atp9a A T 2: 168,516,777 (GRCm39) V430E probably benign Het
Cachd1 G A 4: 100,832,012 (GRCm39) V725I probably benign Het
Ccnb1 G A 13: 100,917,859 (GRCm39) T247M probably damaging Het
Cd40 A T 2: 164,908,431 (GRCm39) D169V probably benign Het
Cdc25c G A 18: 34,880,296 (GRCm39) T146I probably benign Het
Cdhr18 A T 14: 13,896,968 (GRCm38) probably null Het
Ceacam3 C A 7: 16,893,778 (GRCm39) Q430K Het
Cerkl G A 2: 79,171,724 (GRCm39) T378I probably benign Het
Cpn2 G T 16: 30,079,163 (GRCm39) N179K probably damaging Het
Duox1 A G 2: 122,154,869 (GRCm39) D418G probably damaging Het
Eif1ad13 G A 12: 87,762,322 (GRCm39) R14K unknown Het
Eps8l1 C A 7: 4,471,866 (GRCm39) P11T possibly damaging Het
Erc1 C T 6: 119,801,447 (GRCm39) W190* probably null Het
Exosc7 A T 9: 122,959,984 (GRCm39) E195V probably benign Het
F2rl2 A G 13: 95,837,426 (GRCm39) N157S probably damaging Het
Fgd2 T C 17: 29,586,369 (GRCm39) L270P possibly damaging Het
Fitm2 A T 2: 163,312,019 (GRCm39) W65R probably damaging Het
Gabbr1 T G 17: 37,367,861 (GRCm39) I437S possibly damaging Het
Galntl6 A T 8: 58,310,571 (GRCm39) S377T probably benign Het
Gml2 T A 15: 74,693,217 (GRCm39) C73* probably null Het
Htr6 G T 4: 138,789,142 (GRCm39) F304L probably damaging Het
Hydin G A 8: 111,316,092 (GRCm39) G4328D probably damaging Het
Kcnj14 T C 7: 45,467,317 (GRCm39) D343G probably damaging Het
Klhdc1 T A 12: 69,329,942 (GRCm39) I357N probably benign Het
Lcor A G 19: 41,573,024 (GRCm39) D593G probably benign Het
Man2a1 A G 17: 64,973,746 (GRCm39) T341A probably damaging Het
Mrm1 A C 11: 84,709,469 (GRCm39) V196G probably damaging Het
Mybbp1a A G 11: 72,333,727 (GRCm39) probably null Het
Myo19 G A 11: 84,800,093 (GRCm39) C826Y probably benign Het
Nbea A G 3: 55,910,218 (GRCm39) W1326R probably damaging Het
Notch1 A G 2: 26,349,545 (GRCm39) *2532Q probably null Het
Npas2 A G 1: 39,365,228 (GRCm39) Y287C probably damaging Het
Or3a1b G A 11: 74,012,663 (GRCm39) D183N probably damaging Het
Or9g20 T A 2: 85,630,293 (GRCm39) D107V probably benign Het
Pate7 T A 9: 35,688,406 (GRCm39) S60C probably damaging Het
Pcdhga7 C A 18: 37,849,077 (GRCm39) D361E possibly damaging Het
Pde10a T A 17: 9,180,752 (GRCm39) Y447N possibly damaging Het
Piwil2 T A 14: 70,632,890 (GRCm39) I561F probably benign Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Ppp4r4 A G 12: 103,564,407 (GRCm39) T591A probably benign Het
Prxl2c T C 13: 64,460,092 (GRCm39) S84G probably benign Het
Ptprb A G 10: 116,151,156 (GRCm39) T273A probably benign Het
Ptpro T A 6: 137,393,861 (GRCm39) L843* probably null Het
Qrfpr T C 3: 36,243,751 (GRCm39) I117V probably benign Het
Qrich2 T C 11: 116,346,591 (GRCm39) D1411G probably benign Het
Rad51ap2 T C 12: 11,506,656 (GRCm39) S193P probably benign Het
Raver1 T C 9: 20,992,610 (GRCm39) E273G probably benign Het
Rubcn C A 16: 32,688,644 (GRCm39) probably benign Het
S1pr4 C T 10: 81,334,326 (GRCm39) V383I possibly damaging Het
Scn7a T C 2: 66,506,494 (GRCm39) D1465G probably damaging Het
Smarca4 T A 9: 21,558,655 (GRCm39) D607E possibly damaging Het
Srbd1 T A 17: 86,292,882 (GRCm39) I896L possibly damaging Het
Sulf2 G T 2: 165,921,456 (GRCm39) N722K possibly damaging Het
Surf1 A G 2: 26,806,280 (GRCm39) Y22H probably benign Het
Syngr2 A G 11: 117,703,982 (GRCm39) T150A probably benign Het
Szt2 G T 4: 118,223,416 (GRCm39) H3056N unknown Het
Tmf1 A T 6: 97,138,372 (GRCm39) S849T probably benign Het
Tns1 T A 1: 74,130,490 (GRCm39) probably benign Het
Trio G T 15: 27,774,172 (GRCm39) P1764Q probably damaging Het
Trpc3 A T 3: 36,694,821 (GRCm39) V711D probably damaging Het
Ttll3 G T 6: 113,386,298 (GRCm39) K710N probably damaging Het
Utp20 G A 10: 88,636,998 (GRCm39) P738S possibly damaging Het
Vmn2r76 C T 7: 85,877,892 (GRCm39) V502I probably benign Het
Vsig1 C T X: 139,833,875 (GRCm39) H232Y probably benign Het
Wdr64 T G 1: 175,591,511 (GRCm39) F390V probably damaging Het
Ybx3 T G 6: 131,344,826 (GRCm39) T341P possibly damaging Het
Zdhhc11 C A 13: 74,121,866 (GRCm39) Q126K possibly damaging Het
Zfp777 G A 6: 48,002,072 (GRCm39) P673S probably damaging Het
Other mutations in Unc13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Unc13c APN 9 73,643,985 (GRCm39) missense probably damaging 0.99
IGL00693:Unc13c APN 9 73,665,884 (GRCm39) missense probably benign 0.18
IGL01022:Unc13c APN 9 73,424,610 (GRCm39) missense probably benign 0.06
IGL01088:Unc13c APN 9 73,839,563 (GRCm39) missense possibly damaging 0.63
IGL01123:Unc13c APN 9 73,840,479 (GRCm39) missense probably benign 0.05
IGL01131:Unc13c APN 9 73,471,335 (GRCm39) missense probably benign
IGL01135:Unc13c APN 9 73,392,175 (GRCm39) missense probably damaging 1.00
IGL01393:Unc13c APN 9 73,447,552 (GRCm39) missense probably benign 0.06
IGL01752:Unc13c APN 9 73,839,093 (GRCm39) missense probably benign 0.01
IGL01893:Unc13c APN 9 73,600,648 (GRCm39) missense probably benign 0.15
IGL01897:Unc13c APN 9 73,453,309 (GRCm39) missense probably damaging 0.99
IGL01936:Unc13c APN 9 73,600,524 (GRCm39) missense probably benign 0.07
IGL02122:Unc13c APN 9 73,641,679 (GRCm39) splice site probably benign
IGL02341:Unc13c APN 9 73,840,492 (GRCm39) missense possibly damaging 0.76
IGL02434:Unc13c APN 9 73,839,910 (GRCm39) missense probably benign 0.01
IGL02545:Unc13c APN 9 73,388,357 (GRCm39) missense probably damaging 0.98
IGL02709:Unc13c APN 9 73,466,238 (GRCm39) missense probably benign 0.00
IGL02815:Unc13c APN 9 73,447,545 (GRCm39) missense possibly damaging 0.83
IGL02904:Unc13c APN 9 73,388,349 (GRCm39) nonsense probably null
IGL03117:Unc13c APN 9 73,441,307 (GRCm39) missense probably benign 0.03
IGL03260:Unc13c APN 9 73,838,626 (GRCm39) missense probably benign 0.11
Feeling UTSW 9 73,600,553 (GRCm39) missense possibly damaging 0.46
Inkling UTSW 9 73,839,126 (GRCm39) missense probably damaging 1.00
notion UTSW 9 73,643,844 (GRCm39) missense probably damaging 1.00
BB001:Unc13c UTSW 9 73,641,690 (GRCm39) missense probably benign 0.05
BB011:Unc13c UTSW 9 73,641,690 (GRCm39) missense probably benign 0.05
PIT4431001:Unc13c UTSW 9 73,656,829 (GRCm39) missense probably damaging 0.99
PIT4651001:Unc13c UTSW 9 73,391,021 (GRCm39) missense possibly damaging 0.48
R0017:Unc13c UTSW 9 73,600,583 (GRCm39) missense probably benign 0.07
R0039:Unc13c UTSW 9 73,576,847 (GRCm39) splice site probably benign
R0164:Unc13c UTSW 9 73,602,174 (GRCm39) missense probably benign 0.01
R0164:Unc13c UTSW 9 73,602,174 (GRCm39) missense probably benign 0.01
R0308:Unc13c UTSW 9 73,388,400 (GRCm39) missense probably benign 0.04
R0344:Unc13c UTSW 9 73,838,067 (GRCm39) missense probably benign 0.39
R0421:Unc13c UTSW 9 73,840,492 (GRCm39) missense possibly damaging 0.76
R0606:Unc13c UTSW 9 73,438,265 (GRCm39) splice site probably benign
R0655:Unc13c UTSW 9 73,838,235 (GRCm39) missense probably damaging 0.96
R1013:Unc13c UTSW 9 73,840,614 (GRCm39) missense probably benign 0.45
R1293:Unc13c UTSW 9 73,481,356 (GRCm39) missense probably benign 0.06
R1493:Unc13c UTSW 9 73,546,350 (GRCm39) missense probably benign 0.27
R1675:Unc13c UTSW 9 73,546,332 (GRCm39) critical splice donor site probably null
R1789:Unc13c UTSW 9 73,663,621 (GRCm39) missense possibly damaging 0.92
R2001:Unc13c UTSW 9 73,390,897 (GRCm39) splice site probably null
R2055:Unc13c UTSW 9 73,643,832 (GRCm39) missense probably damaging 1.00
R2060:Unc13c UTSW 9 73,572,938 (GRCm39) missense probably damaging 0.99
R2420:Unc13c UTSW 9 73,838,829 (GRCm39) missense probably damaging 0.97
R2421:Unc13c UTSW 9 73,838,829 (GRCm39) missense probably damaging 0.97
R2422:Unc13c UTSW 9 73,838,829 (GRCm39) missense probably damaging 0.97
R3415:Unc13c UTSW 9 73,839,868 (GRCm39) missense probably benign 0.00
R3423:Unc13c UTSW 9 73,837,935 (GRCm39) missense possibly damaging 0.46
R3820:Unc13c UTSW 9 73,838,240 (GRCm39) missense probably benign 0.00
R3857:Unc13c UTSW 9 73,606,390 (GRCm39) nonsense probably null
R3859:Unc13c UTSW 9 73,606,390 (GRCm39) nonsense probably null
R3895:Unc13c UTSW 9 73,840,805 (GRCm39) missense probably benign
R4038:Unc13c UTSW 9 73,441,188 (GRCm39) critical splice donor site probably null
R4077:Unc13c UTSW 9 73,643,821 (GRCm39) nonsense probably null
R4125:Unc13c UTSW 9 73,481,289 (GRCm39) critical splice donor site probably null
R4128:Unc13c UTSW 9 73,641,819 (GRCm39) missense probably damaging 1.00
R4235:Unc13c UTSW 9 73,438,234 (GRCm39) missense possibly damaging 0.68
R4295:Unc13c UTSW 9 73,641,786 (GRCm39) missense probably damaging 1.00
R4307:Unc13c UTSW 9 73,600,649 (GRCm39) missense probably benign 0.06
R4658:Unc13c UTSW 9 73,840,108 (GRCm39) missense probably damaging 1.00
R4694:Unc13c UTSW 9 73,479,636 (GRCm39) missense probably benign 0.00
R4735:Unc13c UTSW 9 73,600,620 (GRCm39) missense probably benign 0.00
R4744:Unc13c UTSW 9 73,839,126 (GRCm39) missense probably damaging 1.00
R4795:Unc13c UTSW 9 73,839,469 (GRCm39) missense probably damaging 0.97
R4827:Unc13c UTSW 9 73,838,568 (GRCm39) missense probably damaging 1.00
R4838:Unc13c UTSW 9 73,839,354 (GRCm39) missense possibly damaging 0.68
R4869:Unc13c UTSW 9 73,587,716 (GRCm39) missense probably benign 0.02
R4873:Unc13c UTSW 9 73,424,566 (GRCm39) missense probably damaging 0.98
R4875:Unc13c UTSW 9 73,424,566 (GRCm39) missense probably damaging 0.98
R4876:Unc13c UTSW 9 73,656,821 (GRCm39) missense probably damaging 1.00
R4905:Unc13c UTSW 9 73,587,674 (GRCm39) missense probably benign
R4912:Unc13c UTSW 9 73,481,304 (GRCm39) missense probably damaging 0.99
R5026:Unc13c UTSW 9 73,838,185 (GRCm39) missense possibly damaging 0.74
R5127:Unc13c UTSW 9 73,840,654 (GRCm39) missense probably benign 0.26
R5151:Unc13c UTSW 9 73,838,757 (GRCm39) missense probably benign 0.02
R5171:Unc13c UTSW 9 73,665,236 (GRCm39) missense probably benign
R5244:Unc13c UTSW 9 73,433,233 (GRCm39) critical splice donor site probably null
R5342:Unc13c UTSW 9 73,838,105 (GRCm39) missense probably benign 0.00
R5399:Unc13c UTSW 9 73,656,970 (GRCm39) missense possibly damaging 0.95
R5409:Unc13c UTSW 9 73,485,672 (GRCm39) missense possibly damaging 0.78
R5460:Unc13c UTSW 9 73,453,271 (GRCm39) missense probably benign
R5680:Unc13c UTSW 9 73,839,884 (GRCm39) missense probably damaging 1.00
R5681:Unc13c UTSW 9 73,453,357 (GRCm39) splice site probably null
R5728:Unc13c UTSW 9 73,466,238 (GRCm39) missense probably benign 0.01
R5762:Unc13c UTSW 9 73,719,649 (GRCm39) missense probably benign 0.00
R5764:Unc13c UTSW 9 73,441,185 (GRCm39) splice site probably null
R5829:Unc13c UTSW 9 73,600,650 (GRCm39) missense probably benign 0.15
R5894:Unc13c UTSW 9 73,600,486 (GRCm39) critical splice donor site probably null
R5936:Unc13c UTSW 9 73,485,774 (GRCm39) missense probably damaging 1.00
R6043:Unc13c UTSW 9 73,643,933 (GRCm39) missense possibly damaging 0.88
R6046:Unc13c UTSW 9 73,838,166 (GRCm39) missense probably benign
R6148:Unc13c UTSW 9 73,600,648 (GRCm39) missense probably benign 0.15
R6207:Unc13c UTSW 9 73,665,910 (GRCm39) missense possibly damaging 0.89
R6277:Unc13c UTSW 9 73,606,451 (GRCm39) missense probably damaging 1.00
R6338:Unc13c UTSW 9 73,641,729 (GRCm39) missense probably damaging 0.99
R6615:Unc13c UTSW 9 73,837,890 (GRCm39) missense possibly damaging 0.63
R6978:Unc13c UTSW 9 73,839,259 (GRCm39) missense probably benign 0.39
R7053:Unc13c UTSW 9 73,839,579 (GRCm39) missense probably damaging 1.00
R7223:Unc13c UTSW 9 73,536,473 (GRCm39) missense probably benign 0.44
R7259:Unc13c UTSW 9 73,424,645 (GRCm39) missense probably benign 0.00
R7353:Unc13c UTSW 9 73,481,355 (GRCm39) missense probably benign 0.00
R7357:Unc13c UTSW 9 73,840,811 (GRCm39) small insertion probably benign
R7357:Unc13c UTSW 9 73,840,810 (GRCm39) small insertion probably benign
R7607:Unc13c UTSW 9 73,576,817 (GRCm39) missense probably damaging 0.98
R7626:Unc13c UTSW 9 73,641,799 (GRCm39) missense probably damaging 1.00
R7639:Unc13c UTSW 9 73,840,450 (GRCm39) missense probably damaging 0.99
R7657:Unc13c UTSW 9 73,441,185 (GRCm39) splice site probably null
R7665:Unc13c UTSW 9 73,587,756 (GRCm39) missense probably benign 0.28
R7704:Unc13c UTSW 9 73,606,494 (GRCm39) missense probably benign 0.27
R7776:Unc13c UTSW 9 73,602,232 (GRCm39) missense probably damaging 1.00
R7811:Unc13c UTSW 9 73,600,553 (GRCm39) missense possibly damaging 0.46
R7839:Unc13c UTSW 9 73,840,596 (GRCm39) missense possibly damaging 0.63
R7869:Unc13c UTSW 9 73,602,159 (GRCm39) missense probably damaging 1.00
R7924:Unc13c UTSW 9 73,641,690 (GRCm39) missense probably benign 0.05
R8047:Unc13c UTSW 9 73,719,636 (GRCm39) nonsense probably null
R8167:Unc13c UTSW 9 73,643,985 (GRCm39) missense probably damaging 0.99
R8202:Unc13c UTSW 9 73,643,844 (GRCm39) missense probably damaging 1.00
R8210:Unc13c UTSW 9 73,392,220 (GRCm39) missense probably benign 0.13
R8352:Unc13c UTSW 9 73,838,290 (GRCm39) missense probably damaging 0.99
R8368:Unc13c UTSW 9 73,838,070 (GRCm39) missense probably benign 0.15
R8452:Unc13c UTSW 9 73,838,290 (GRCm39) missense probably damaging 0.99
R8535:Unc13c UTSW 9 73,447,653 (GRCm39) missense probably benign
R8677:Unc13c UTSW 9 73,840,243 (GRCm39) missense probably benign 0.00
R8700:Unc13c UTSW 9 73,479,679 (GRCm39) missense probably benign 0.44
R8848:Unc13c UTSW 9 73,433,263 (GRCm39) missense probably benign
R8902:Unc13c UTSW 9 73,656,830 (GRCm39) missense probably damaging 0.97
R8953:Unc13c UTSW 9 73,840,044 (GRCm39) missense probably benign 0.00
R8961:Unc13c UTSW 9 73,839,524 (GRCm39) missense probably benign 0.06
R9015:Unc13c UTSW 9 73,453,322 (GRCm39) missense probably benign
R9114:Unc13c UTSW 9 73,719,665 (GRCm39) missense probably benign 0.02
R9217:Unc13c UTSW 9 73,485,715 (GRCm39) missense probably damaging 1.00
R9252:Unc13c UTSW 9 73,424,553 (GRCm39) missense possibly damaging 0.80
R9273:Unc13c UTSW 9 73,839,862 (GRCm39) missense possibly damaging 0.96
R9317:Unc13c UTSW 9 73,447,662 (GRCm39) missense possibly damaging 0.88
R9412:Unc13c UTSW 9 73,839,772 (GRCm39) missense probably benign
R9505:Unc13c UTSW 9 73,838,824 (GRCm39) missense probably benign 0.22
R9516:Unc13c UTSW 9 73,392,220 (GRCm39) missense probably damaging 0.99
R9528:Unc13c UTSW 9 73,837,960 (GRCm39) missense possibly damaging 0.48
R9567:Unc13c UTSW 9 73,536,485 (GRCm39) missense probably damaging 0.99
R9756:Unc13c UTSW 9 73,839,526 (GRCm39) missense probably benign 0.23
R9783:Unc13c UTSW 9 73,392,227 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGGTCCTCTGAGAGAGTATTCTGAG -3'
(R):5'- GGCAAAAGTCTGACACATCTGC -3'

Sequencing Primer
(F):5'- AGAGTATTCTGAGGATGGTTAAACC -3'
(R):5'- GTCTGACACATCTGCAATAAAGC -3'
Posted On 2019-12-20