Incidental Mutation 'R7833:Utp20'
ID 605790
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene Name UTP20 small subunit processome component
Synonyms DRIM, 3830408P06Rik, mDRIM
MMRRC Submission 045887-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R7833 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 88582469-88662666 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 88636998 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 738 (P738S)
Ref Sequence ENSEMBL: ENSMUSP00000004470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000004470
AA Change: P738S

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: P738S

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,902,059 (GRCm39) S578T possibly damaging Het
Acot5 A G 12: 84,122,601 (GRCm39) Q395R probably damaging Het
Adamts15 T A 9: 30,833,401 (GRCm39) T45S probably benign Het
Agbl2 A G 2: 90,645,777 (GRCm39) K837E probably benign Het
Atf2 T C 2: 73,684,229 (GRCm39) T19A possibly damaging Het
Atp6v0a2 T C 5: 124,782,969 (GRCm39) V238A probably damaging Het
Atp9a A T 2: 168,516,777 (GRCm39) V430E probably benign Het
Cachd1 G A 4: 100,832,012 (GRCm39) V725I probably benign Het
Ccnb1 G A 13: 100,917,859 (GRCm39) T247M probably damaging Het
Cd40 A T 2: 164,908,431 (GRCm39) D169V probably benign Het
Cdc25c G A 18: 34,880,296 (GRCm39) T146I probably benign Het
Cdhr18 A T 14: 13,896,968 (GRCm38) probably null Het
Ceacam3 C A 7: 16,893,778 (GRCm39) Q430K Het
Cerkl G A 2: 79,171,724 (GRCm39) T378I probably benign Het
Cpn2 G T 16: 30,079,163 (GRCm39) N179K probably damaging Het
Duox1 A G 2: 122,154,869 (GRCm39) D418G probably damaging Het
Eif1ad13 G A 12: 87,762,322 (GRCm39) R14K unknown Het
Eps8l1 C A 7: 4,471,866 (GRCm39) P11T possibly damaging Het
Erc1 C T 6: 119,801,447 (GRCm39) W190* probably null Het
Exosc7 A T 9: 122,959,984 (GRCm39) E195V probably benign Het
F2rl2 A G 13: 95,837,426 (GRCm39) N157S probably damaging Het
Fgd2 T C 17: 29,586,369 (GRCm39) L270P possibly damaging Het
Fitm2 A T 2: 163,312,019 (GRCm39) W65R probably damaging Het
Gabbr1 T G 17: 37,367,861 (GRCm39) I437S possibly damaging Het
Galntl6 A T 8: 58,310,571 (GRCm39) S377T probably benign Het
Gml2 T A 15: 74,693,217 (GRCm39) C73* probably null Het
Htr6 G T 4: 138,789,142 (GRCm39) F304L probably damaging Het
Hydin G A 8: 111,316,092 (GRCm39) G4328D probably damaging Het
Kcnj14 T C 7: 45,467,317 (GRCm39) D343G probably damaging Het
Klhdc1 T A 12: 69,329,942 (GRCm39) I357N probably benign Het
Lcor A G 19: 41,573,024 (GRCm39) D593G probably benign Het
Man2a1 A G 17: 64,973,746 (GRCm39) T341A probably damaging Het
Mrm1 A C 11: 84,709,469 (GRCm39) V196G probably damaging Het
Mybbp1a A G 11: 72,333,727 (GRCm39) probably null Het
Myo19 G A 11: 84,800,093 (GRCm39) C826Y probably benign Het
Nbea A G 3: 55,910,218 (GRCm39) W1326R probably damaging Het
Notch1 A G 2: 26,349,545 (GRCm39) *2532Q probably null Het
Npas2 A G 1: 39,365,228 (GRCm39) Y287C probably damaging Het
Or3a1b G A 11: 74,012,663 (GRCm39) D183N probably damaging Het
Or9g20 T A 2: 85,630,293 (GRCm39) D107V probably benign Het
Pate7 T A 9: 35,688,406 (GRCm39) S60C probably damaging Het
Pcdhga7 C A 18: 37,849,077 (GRCm39) D361E possibly damaging Het
Pde10a T A 17: 9,180,752 (GRCm39) Y447N possibly damaging Het
Piwil2 T A 14: 70,632,890 (GRCm39) I561F probably benign Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Ppp4r4 A G 12: 103,564,407 (GRCm39) T591A probably benign Het
Prxl2c T C 13: 64,460,092 (GRCm39) S84G probably benign Het
Ptprb A G 10: 116,151,156 (GRCm39) T273A probably benign Het
Ptpro T A 6: 137,393,861 (GRCm39) L843* probably null Het
Qrfpr T C 3: 36,243,751 (GRCm39) I117V probably benign Het
Qrich2 T C 11: 116,346,591 (GRCm39) D1411G probably benign Het
Rad51ap2 T C 12: 11,506,656 (GRCm39) S193P probably benign Het
Raver1 T C 9: 20,992,610 (GRCm39) E273G probably benign Het
Rubcn C A 16: 32,688,644 (GRCm39) probably benign Het
S1pr4 C T 10: 81,334,326 (GRCm39) V383I possibly damaging Het
Scn7a T C 2: 66,506,494 (GRCm39) D1465G probably damaging Het
Smarca4 T A 9: 21,558,655 (GRCm39) D607E possibly damaging Het
Srbd1 T A 17: 86,292,882 (GRCm39) I896L possibly damaging Het
Sulf2 G T 2: 165,921,456 (GRCm39) N722K possibly damaging Het
Surf1 A G 2: 26,806,280 (GRCm39) Y22H probably benign Het
Syngr2 A G 11: 117,703,982 (GRCm39) T150A probably benign Het
Szt2 G T 4: 118,223,416 (GRCm39) H3056N unknown Het
Tmf1 A T 6: 97,138,372 (GRCm39) S849T probably benign Het
Tns1 T A 1: 74,130,490 (GRCm39) probably benign Het
Trio G T 15: 27,774,172 (GRCm39) P1764Q probably damaging Het
Trpc3 A T 3: 36,694,821 (GRCm39) V711D probably damaging Het
Ttll3 G T 6: 113,386,298 (GRCm39) K710N probably damaging Het
Unc13c A G 9: 73,388,391 (GRCm39) S2132P possibly damaging Het
Vmn2r76 C T 7: 85,877,892 (GRCm39) V502I probably benign Het
Vsig1 C T X: 139,833,875 (GRCm39) H232Y probably benign Het
Wdr64 T G 1: 175,591,511 (GRCm39) F390V probably damaging Het
Ybx3 T G 6: 131,344,826 (GRCm39) T341P possibly damaging Het
Zdhhc11 C A 13: 74,121,866 (GRCm39) Q126K possibly damaging Het
Zfp777 G A 6: 48,002,072 (GRCm39) P673S probably damaging Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88,661,306 (GRCm39) missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88,644,987 (GRCm39) missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88,645,000 (GRCm39) missense probably benign
IGL00946:Utp20 APN 10 88,584,177 (GRCm39) missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88,606,566 (GRCm39) missense probably benign 0.13
IGL01399:Utp20 APN 10 88,594,164 (GRCm39) critical splice donor site probably null
IGL01548:Utp20 APN 10 88,600,643 (GRCm39) missense probably damaging 1.00
IGL01587:Utp20 APN 10 88,623,397 (GRCm39) missense probably damaging 0.98
IGL01789:Utp20 APN 10 88,634,141 (GRCm39) critical splice donor site probably null
IGL01819:Utp20 APN 10 88,628,549 (GRCm39) missense probably damaging 1.00
IGL02070:Utp20 APN 10 88,657,739 (GRCm39) splice site probably benign
IGL02231:Utp20 APN 10 88,627,030 (GRCm39) missense probably damaging 1.00
IGL02244:Utp20 APN 10 88,651,818 (GRCm39) splice site probably benign
IGL02367:Utp20 APN 10 88,607,715 (GRCm39) unclassified probably benign
IGL02553:Utp20 APN 10 88,600,657 (GRCm39) missense probably damaging 0.99
IGL02748:Utp20 APN 10 88,653,157 (GRCm39) missense probably benign 0.00
IGL02831:Utp20 APN 10 88,651,770 (GRCm39) missense probably benign
IGL02986:Utp20 APN 10 88,611,147 (GRCm39) missense probably damaging 1.00
IGL02997:Utp20 APN 10 88,649,896 (GRCm39) missense probably benign
IGL03105:Utp20 APN 10 88,626,958 (GRCm39) missense probably benign 0.10
IGL03251:Utp20 APN 10 88,653,188 (GRCm39) critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88,590,428 (GRCm39) missense probably benign
IGL03348:Utp20 APN 10 88,594,179 (GRCm39) missense probably benign 0.09
IGL03381:Utp20 APN 10 88,657,867 (GRCm39) missense probably damaging 0.99
Bell UTSW 10 88,628,487 (GRCm39) missense probably benign 0.29
elite UTSW 10 88,606,670 (GRCm39) missense probably benign
Margin UTSW 10 88,604,541 (GRCm39) missense probably benign 0.04
Percentile UTSW 10 88,611,180 (GRCm39) missense probably damaging 1.00
R0037:Utp20 UTSW 10 88,634,266 (GRCm39) missense probably benign 0.05
R0107:Utp20 UTSW 10 88,614,253 (GRCm39) missense probably benign 0.03
R0197:Utp20 UTSW 10 88,613,378 (GRCm39) missense probably benign 0.22
R0219:Utp20 UTSW 10 88,600,537 (GRCm39) missense probably damaging 1.00
R0315:Utp20 UTSW 10 88,643,283 (GRCm39) missense probably damaging 1.00
R0328:Utp20 UTSW 10 88,602,969 (GRCm39) missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88,653,841 (GRCm39) missense probably benign 0.00
R0330:Utp20 UTSW 10 88,653,841 (GRCm39) missense probably benign 0.00
R0395:Utp20 UTSW 10 88,654,457 (GRCm39) missense probably damaging 1.00
R0399:Utp20 UTSW 10 88,656,841 (GRCm39) missense probably damaging 1.00
R0454:Utp20 UTSW 10 88,657,931 (GRCm39) missense probably benign 0.00
R0456:Utp20 UTSW 10 88,590,435 (GRCm39) missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88,596,774 (GRCm39) missense probably damaging 1.00
R0557:Utp20 UTSW 10 88,584,173 (GRCm39) missense probably damaging 0.99
R0600:Utp20 UTSW 10 88,603,323 (GRCm39) missense probably damaging 1.00
R0616:Utp20 UTSW 10 88,606,613 (GRCm39) missense probably benign 0.14
R1076:Utp20 UTSW 10 88,608,405 (GRCm39) missense possibly damaging 0.86
R1076:Utp20 UTSW 10 88,608,321 (GRCm39) missense probably benign 0.36
R1330:Utp20 UTSW 10 88,637,051 (GRCm39) missense probably damaging 0.96
R1440:Utp20 UTSW 10 88,655,201 (GRCm39) missense probably benign 0.19
R1529:Utp20 UTSW 10 88,588,868 (GRCm39) missense probably damaging 1.00
R1554:Utp20 UTSW 10 88,600,599 (GRCm39) nonsense probably null
R1621:Utp20 UTSW 10 88,598,733 (GRCm39) missense probably benign
R1641:Utp20 UTSW 10 88,593,834 (GRCm39) missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88,585,159 (GRCm39) missense probably benign 0.29
R1734:Utp20 UTSW 10 88,603,323 (GRCm39) missense probably damaging 1.00
R1755:Utp20 UTSW 10 88,645,631 (GRCm39) missense probably benign 0.01
R1775:Utp20 UTSW 10 88,606,670 (GRCm39) missense probably benign
R1866:Utp20 UTSW 10 88,598,632 (GRCm39) nonsense probably null
R1867:Utp20 UTSW 10 88,585,305 (GRCm39) missense probably benign
R1901:Utp20 UTSW 10 88,588,888 (GRCm39) missense probably benign 0.02
R1902:Utp20 UTSW 10 88,588,888 (GRCm39) missense probably benign 0.02
R1967:Utp20 UTSW 10 88,652,841 (GRCm39) missense probably benign 0.03
R2060:Utp20 UTSW 10 88,610,657 (GRCm39) missense probably damaging 0.98
R2102:Utp20 UTSW 10 88,608,779 (GRCm39) missense probably damaging 0.99
R2110:Utp20 UTSW 10 88,603,313 (GRCm39) critical splice donor site probably null
R2115:Utp20 UTSW 10 88,621,865 (GRCm39) missense probably benign 0.02
R2128:Utp20 UTSW 10 88,649,917 (GRCm39) missense probably damaging 0.99
R2129:Utp20 UTSW 10 88,649,917 (GRCm39) missense probably damaging 0.99
R2180:Utp20 UTSW 10 88,656,801 (GRCm39) missense probably damaging 0.98
R2280:Utp20 UTSW 10 88,661,365 (GRCm39) splice site probably null
R2435:Utp20 UTSW 10 88,656,753 (GRCm39) missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88,590,337 (GRCm39) critical splice donor site probably null
R3005:Utp20 UTSW 10 88,613,317 (GRCm39) missense probably damaging 0.97
R3546:Utp20 UTSW 10 88,618,551 (GRCm39) missense probably damaging 1.00
R3547:Utp20 UTSW 10 88,618,551 (GRCm39) missense probably damaging 1.00
R3622:Utp20 UTSW 10 88,593,855 (GRCm39) unclassified probably benign
R3737:Utp20 UTSW 10 88,598,668 (GRCm39) missense probably benign 0.00
R3738:Utp20 UTSW 10 88,598,668 (GRCm39) missense probably benign 0.00
R3841:Utp20 UTSW 10 88,611,065 (GRCm39) unclassified probably benign
R4034:Utp20 UTSW 10 88,598,668 (GRCm39) missense probably benign 0.00
R4035:Utp20 UTSW 10 88,598,668 (GRCm39) missense probably benign 0.00
R4157:Utp20 UTSW 10 88,597,729 (GRCm39) missense probably benign
R4243:Utp20 UTSW 10 88,643,187 (GRCm39) critical splice donor site probably null
R4295:Utp20 UTSW 10 88,590,381 (GRCm39) missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88,614,123 (GRCm39) missense probably damaging 1.00
R4633:Utp20 UTSW 10 88,588,814 (GRCm39) missense probably benign
R4684:Utp20 UTSW 10 88,643,307 (GRCm39) nonsense probably null
R4731:Utp20 UTSW 10 88,590,382 (GRCm39) missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88,652,780 (GRCm39) missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88,645,797 (GRCm39) missense probably benign 0.09
R4912:Utp20 UTSW 10 88,607,822 (GRCm39) missense probably benign 0.01
R4974:Utp20 UTSW 10 88,652,811 (GRCm39) missense probably benign 0.08
R4991:Utp20 UTSW 10 88,582,796 (GRCm39) missense probably benign 0.09
R5004:Utp20 UTSW 10 88,584,135 (GRCm39) missense probably damaging 0.98
R5037:Utp20 UTSW 10 88,611,192 (GRCm39) missense probably benign 0.00
R5043:Utp20 UTSW 10 88,634,608 (GRCm39) missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88,604,735 (GRCm39) missense probably benign 0.00
R5138:Utp20 UTSW 10 88,583,239 (GRCm39) missense probably damaging 0.96
R5252:Utp20 UTSW 10 88,586,532 (GRCm39) missense probably benign 0.01
R5394:Utp20 UTSW 10 88,608,777 (GRCm39) nonsense probably null
R5470:Utp20 UTSW 10 88,653,758 (GRCm39) missense probably benign 0.14
R5558:Utp20 UTSW 10 88,587,329 (GRCm39) missense probably damaging 1.00
R5678:Utp20 UTSW 10 88,644,979 (GRCm39) missense probably benign 0.00
R5822:Utp20 UTSW 10 88,653,147 (GRCm39) missense probably benign 0.00
R5866:Utp20 UTSW 10 88,608,421 (GRCm39) missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88,651,784 (GRCm39) missense probably benign 0.00
R6026:Utp20 UTSW 10 88,604,541 (GRCm39) missense probably benign 0.04
R6363:Utp20 UTSW 10 88,592,942 (GRCm39) missense probably damaging 1.00
R6434:Utp20 UTSW 10 88,608,395 (GRCm39) nonsense probably null
R6477:Utp20 UTSW 10 88,604,780 (GRCm39) missense probably benign 0.05
R6480:Utp20 UTSW 10 88,591,048 (GRCm39) critical splice donor site probably null
R6989:Utp20 UTSW 10 88,614,102 (GRCm39) missense probably benign 0.00
R7033:Utp20 UTSW 10 88,590,337 (GRCm39) critical splice donor site probably null
R7192:Utp20 UTSW 10 88,608,321 (GRCm39) missense probably benign 0.09
R7236:Utp20 UTSW 10 88,585,204 (GRCm39) missense probably benign 0.28
R7260:Utp20 UTSW 10 88,587,334 (GRCm39) missense probably benign 0.39
R7296:Utp20 UTSW 10 88,606,586 (GRCm39) missense probably benign 0.21
R7317:Utp20 UTSW 10 88,598,797 (GRCm39) missense possibly damaging 0.83
R7318:Utp20 UTSW 10 88,649,811 (GRCm39) missense possibly damaging 0.89
R7330:Utp20 UTSW 10 88,623,424 (GRCm39) frame shift probably null
R7367:Utp20 UTSW 10 88,631,305 (GRCm39) missense probably benign 0.21
R7432:Utp20 UTSW 10 88,634,260 (GRCm39) missense probably benign 0.00
R7447:Utp20 UTSW 10 88,608,354 (GRCm39) missense probably damaging 1.00
R7473:Utp20 UTSW 10 88,656,572 (GRCm39) splice site probably null
R7520:Utp20 UTSW 10 88,654,457 (GRCm39) missense probably damaging 1.00
R7530:Utp20 UTSW 10 88,588,868 (GRCm39) missense probably damaging 1.00
R7539:Utp20 UTSW 10 88,627,607 (GRCm39) missense probably damaging 1.00
R7651:Utp20 UTSW 10 88,590,457 (GRCm39) missense probably benign 0.41
R7728:Utp20 UTSW 10 88,634,203 (GRCm39) missense probably damaging 1.00
R7831:Utp20 UTSW 10 88,598,632 (GRCm39) nonsense probably null
R7909:Utp20 UTSW 10 88,611,192 (GRCm39) missense probably benign
R7956:Utp20 UTSW 10 88,618,476 (GRCm39) missense probably benign 0.23
R7999:Utp20 UTSW 10 88,606,250 (GRCm39) missense probably benign
R8080:Utp20 UTSW 10 88,618,577 (GRCm39) missense possibly damaging 0.82
R8098:Utp20 UTSW 10 88,588,810 (GRCm39) missense probably benign 0.13
R8104:Utp20 UTSW 10 88,593,766 (GRCm39) missense probably damaging 1.00
R8129:Utp20 UTSW 10 88,628,487 (GRCm39) missense probably benign 0.29
R8147:Utp20 UTSW 10 88,594,306 (GRCm39) missense probably benign 0.02
R8199:Utp20 UTSW 10 88,634,337 (GRCm39) missense probably benign
R8222:Utp20 UTSW 10 88,614,234 (GRCm39) missense probably damaging 1.00
R8415:Utp20 UTSW 10 88,662,466 (GRCm39) critical splice donor site probably null
R8466:Utp20 UTSW 10 88,654,365 (GRCm39) missense probably damaging 1.00
R8505:Utp20 UTSW 10 88,653,870 (GRCm39) missense probably benign 0.03
R8774:Utp20 UTSW 10 88,588,763 (GRCm39) splice site probably benign
R8802:Utp20 UTSW 10 88,583,157 (GRCm39) missense probably damaging 1.00
R8923:Utp20 UTSW 10 88,627,604 (GRCm39) nonsense probably null
R8945:Utp20 UTSW 10 88,628,532 (GRCm39) nonsense probably null
R9065:Utp20 UTSW 10 88,592,972 (GRCm39) missense probably benign 0.32
R9092:Utp20 UTSW 10 88,611,180 (GRCm39) missense probably damaging 1.00
R9092:Utp20 UTSW 10 88,604,679 (GRCm39) missense probably benign
R9094:Utp20 UTSW 10 88,611,180 (GRCm39) missense probably damaging 1.00
R9095:Utp20 UTSW 10 88,611,180 (GRCm39) missense probably damaging 1.00
R9096:Utp20 UTSW 10 88,611,180 (GRCm39) missense probably damaging 1.00
R9229:Utp20 UTSW 10 88,594,239 (GRCm39) missense possibly damaging 0.86
R9323:Utp20 UTSW 10 88,583,170 (GRCm39) missense probably damaging 1.00
R9336:Utp20 UTSW 10 88,649,798 (GRCm39) missense probably damaging 1.00
R9467:Utp20 UTSW 10 88,640,390 (GRCm39) missense possibly damaging 0.68
R9545:Utp20 UTSW 10 88,618,511 (GRCm39) missense probably benign 0.38
R9659:Utp20 UTSW 10 88,653,171 (GRCm39) missense probably damaging 1.00
R9788:Utp20 UTSW 10 88,653,171 (GRCm39) missense probably damaging 1.00
RF005:Utp20 UTSW 10 88,661,319 (GRCm39) missense probably damaging 1.00
RF024:Utp20 UTSW 10 88,661,319 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAAACCCTCCAGTCATTTAAGTGC -3'
(R):5'- TGCAAGCGTCTTCCCAAAC -3'

Sequencing Primer
(F):5'- GCACTGAAATATTTGTATAGCTAGCC -3'
(R):5'- ACCCCACTTTCTCCAAGGG -3'
Posted On 2019-12-20