Incidental Mutation 'R7833:Ptprb'
ID605791
Institutional Source Beutler Lab
Gene Symbol Ptprb
Ensembl Gene ENSMUSG00000020154
Gene Nameprotein tyrosine phosphatase, receptor type, B
Synonyms3230402H02Rik, VE-PTP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7833 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location116275523-116389535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116315251 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 273 (T273A)
Ref Sequence ENSEMBL: ENSMUSP00000089805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092167] [ENSMUST00000218553]
Predicted Effect probably benign
Transcript: ENSMUST00000092167
AA Change: T273A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000089805
Gene: ENSMUSG00000020154
AA Change: T273A

DomainStartEndE-ValueType
FN3 22 102 8.23e1 SMART
FN3 111 193 1.73e-5 SMART
FN3 204 281 1.56e-3 SMART
FN3 290 366 6.45e-5 SMART
FN3 378 459 5e-2 SMART
FN3 468 546 1.61e-5 SMART
FN3 555 632 7.18e-3 SMART
FN3 644 724 7.52e-6 SMART
FN3 732 811 2.92e-3 SMART
FN3 820 899 2.76e-4 SMART
FN3 908 987 1.29e-4 SMART
FN3 996 1075 7.7e-3 SMART
FN3 1086 1166 1.21e0 SMART
FN3 1174 1253 5.08e-3 SMART
FN3 1262 1340 1.17e-7 SMART
FN3 1356 1435 2.68e-2 SMART
Blast:FN3 1450 1591 6e-88 BLAST
transmembrane domain 1620 1642 N/A INTRINSIC
Blast:PTPc 1643 1681 3e-11 BLAST
PTPc 1703 1966 1.05e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218553
AA Change: T560A

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,312,278 S84G probably benign Het
Acin1 A T 14: 54,664,602 S578T possibly damaging Het
Acot5 A G 12: 84,075,827 Q395R probably damaging Het
Adamts15 T A 9: 30,922,105 T45S probably benign Het
Agbl2 A G 2: 90,815,433 K837E probably benign Het
Atf2 T C 2: 73,853,885 T19A possibly damaging Het
Atp6v0a2 T C 5: 124,645,031 V238A probably damaging Het
Atp9a A T 2: 168,674,857 V430E probably benign Het
Cachd1 G A 4: 100,974,815 V725I probably benign Het
Ccnb1 G A 13: 100,781,351 T247M probably damaging Het
Cd40 A T 2: 165,066,511 D169V probably benign Het
Cdc25c G A 18: 34,747,243 T146I probably benign Het
Ceacam3 C A 7: 17,159,853 Q430K Het
Cerkl G A 2: 79,341,380 T378I probably benign Het
Cpn2 G T 16: 30,260,345 N179K probably damaging Het
Duox1 A G 2: 122,324,388 D418G probably damaging Het
Eps8l1 C A 7: 4,468,867 P11T possibly damaging Het
Erc1 C T 6: 119,824,486 W190* probably null Het
Exosc7 A T 9: 123,130,919 E195V probably benign Het
F2rl2 A G 13: 95,700,918 N157S probably damaging Het
Fgd2 T C 17: 29,367,395 L270P possibly damaging Het
Fitm2 A T 2: 163,470,099 W65R probably damaging Het
Gabbr1 T G 17: 37,056,969 I437S possibly damaging Het
Galntl6 A T 8: 57,857,537 S377T probably benign Het
Gm17727 T A 9: 35,777,110 S60C probably damaging Het
Gm21936 G A 12: 87,795,552 R14K unknown Het
Gm281 A T 14: 13,896,968 probably null Het
Gm340 A G 19: 41,584,585 D593G probably benign Het
Gml2 T A 15: 74,821,368 C73* probably null Het
Htr6 G T 4: 139,061,831 F304L probably damaging Het
Hydin G A 8: 110,589,460 G4328D probably damaging Het
Kcnj14 T C 7: 45,817,893 D343G probably damaging Het
Klhdc1 T A 12: 69,283,168 I357N probably benign Het
Man2a1 A G 17: 64,666,751 T341A probably damaging Het
Mrm1 A C 11: 84,818,643 V196G probably damaging Het
Mybbp1a A G 11: 72,442,901 probably null Het
Myo19 G A 11: 84,909,267 C826Y probably benign Het
Nbea A G 3: 56,002,797 W1326R probably damaging Het
Notch1 A G 2: 26,459,533 *2532Q probably null Het
Npas2 A G 1: 39,326,147 Y287C probably damaging Het
Olfr1016 T A 2: 85,799,949 D107V probably benign Het
Olfr401 G A 11: 74,121,837 D183N probably damaging Het
Pcdhga7 C A 18: 37,716,024 D361E possibly damaging Het
Pde10a T A 17: 8,961,920 Y447N possibly damaging Het
Piwil2 T A 14: 70,395,441 I561F probably benign Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ppp4r4 A G 12: 103,598,148 T591A probably benign Het
Ptpro T A 6: 137,416,863 L843* probably null Het
Qrfpr T C 3: 36,189,602 I117V probably benign Het
Qrich2 T C 11: 116,455,765 D1411G probably benign Het
Rad51ap2 T C 12: 11,456,655 S193P probably benign Het
Raver1 T C 9: 21,081,314 E273G probably benign Het
Rubcn C A 16: 32,868,274 probably benign Het
S1pr4 C T 10: 81,498,492 V383I possibly damaging Het
Scn7a T C 2: 66,676,150 D1465G probably damaging Het
Smarca4 T A 9: 21,647,359 D607E possibly damaging Het
Srbd1 T A 17: 85,985,454 I896L possibly damaging Het
Sulf2 G T 2: 166,079,536 N722K possibly damaging Het
Surf1 A G 2: 26,916,268 Y22H probably benign Het
Syngr2 A G 11: 117,813,156 T150A probably benign Het
Szt2 G T 4: 118,366,219 H3056N unknown Het
Tmf1 A T 6: 97,161,411 S849T probably benign Het
Tns1 T A 1: 74,091,331 probably benign Het
Trio G T 15: 27,774,086 P1764Q probably damaging Het
Trpc3 A T 3: 36,640,672 V711D probably damaging Het
Ttll3 G T 6: 113,409,337 K710N probably damaging Het
Unc13c A G 9: 73,481,109 S2132P possibly damaging Het
Utp20 G A 10: 88,801,136 P738S possibly damaging Het
Vmn2r76 C T 7: 86,228,684 V502I probably benign Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdr64 T G 1: 175,763,945 F390V probably damaging Het
Ybx3 T G 6: 131,367,863 T341P possibly damaging Het
Zdhhc11 C A 13: 73,973,747 Q126K possibly damaging Het
Zfp777 G A 6: 48,025,138 P673S probably damaging Het
Other mutations in Ptprb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Ptprb APN 10 116362648 missense probably benign 0.15
IGL01354:Ptprb APN 10 116343891 missense probably benign 0.24
IGL01404:Ptprb APN 10 116339436 missense probably benign 0.14
IGL01410:Ptprb APN 10 116302274 missense possibly damaging 0.60
IGL01412:Ptprb APN 10 116343915 missense probably benign 0.27
IGL01731:Ptprb APN 10 116372876 missense probably damaging 1.00
IGL02003:Ptprb APN 10 116367505 missense probably damaging 1.00
IGL02110:Ptprb APN 10 116331203 splice site probably benign
IGL02178:Ptprb APN 10 116322532 missense probably benign 0.00
IGL02304:Ptprb APN 10 116331259 missense probably damaging 1.00
IGL02324:Ptprb APN 10 116319333 missense probably benign 0.03
IGL02388:Ptprb APN 10 116367521 missense probably damaging 1.00
IGL02640:Ptprb APN 10 116338664 missense probably damaging 0.99
IGL02698:Ptprb APN 10 116363280 missense probably benign 0.05
IGL02876:Ptprb APN 10 116348211 splice site probably benign
IGL02879:Ptprb APN 10 116327968 missense probably benign
IGL02982:Ptprb APN 10 116322628 missense probably benign 0.20
IGL03146:Ptprb APN 10 116328127 missense probably benign 0.14
IGL03351:Ptprb APN 10 116339582 missense probably benign 0.03
R0306:Ptprb UTSW 10 116343988 missense probably benign 0.04
R0385:Ptprb UTSW 10 116350178 missense probably benign 0.00
R0600:Ptprb UTSW 10 116368807 missense possibly damaging 0.63
R0613:Ptprb UTSW 10 116302325 missense possibly damaging 0.59
R0613:Ptprb UTSW 10 116302378 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116302125 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116339510 missense probably damaging 1.00
R1331:Ptprb UTSW 10 116367532 missense probably damaging 1.00
R1413:Ptprb UTSW 10 116339679 missense probably damaging 1.00
R1418:Ptprb UTSW 10 116319470 missense probably benign 0.00
R1545:Ptprb UTSW 10 116380869 missense probably damaging 1.00
R1562:Ptprb UTSW 10 116339467 missense probably benign 0.00
R1752:Ptprb UTSW 10 116340990 missense probably benign 0.44
R1837:Ptprb UTSW 10 116341626 missense probably benign 0.00
R1940:Ptprb UTSW 10 116319610 splice site probably benign
R1958:Ptprb UTSW 10 116341536 missense probably benign 0.10
R2029:Ptprb UTSW 10 116347053 missense probably benign 0.37
R2031:Ptprb UTSW 10 116317543 missense probably benign
R2101:Ptprb UTSW 10 116315038 splice site probably benign
R2209:Ptprb UTSW 10 116369357 missense probably damaging 1.00
R3016:Ptprb UTSW 10 116357295 missense possibly damaging 0.64
R3076:Ptprb UTSW 10 116344026 missense probably damaging 0.99
R3821:Ptprb UTSW 10 116350074 missense probably benign 0.11
R3824:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3825:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3841:Ptprb UTSW 10 116346982 missense possibly damaging 0.79
R3953:Ptprb UTSW 10 116341494 missense probably benign 0.00
R4125:Ptprb UTSW 10 116353849 missense probably benign 0.12
R4227:Ptprb UTSW 10 116302225 missense possibly damaging 0.96
R4385:Ptprb UTSW 10 116346867 missense probably benign
R4731:Ptprb UTSW 10 116319333 missense probably benign 0.03
R5009:Ptprb UTSW 10 116348127 missense possibly damaging 0.61
R5104:Ptprb UTSW 10 116322459 missense probably benign 0.17
R5114:Ptprb UTSW 10 116348183 missense possibly damaging 0.59
R5145:Ptprb UTSW 10 116343915 missense probably benign 0.27
R5214:Ptprb UTSW 10 116369324 missense possibly damaging 0.75
R5382:Ptprb UTSW 10 116353871 missense probably damaging 1.00
R5553:Ptprb UTSW 10 116350185 missense probably damaging 1.00
R5585:Ptprb UTSW 10 116380854 missense probably damaging 0.98
R5586:Ptprb UTSW 10 116353827 missense probably damaging 1.00
R5808:Ptprb UTSW 10 116339487 missense probably benign 0.00
R5875:Ptprb UTSW 10 116348166 missense probably benign 0.00
R6051:Ptprb UTSW 10 116341090 nonsense probably null
R6383:Ptprb UTSW 10 116347007 nonsense probably null
R6511:Ptprb UTSW 10 116346820 missense probably damaging 1.00
R6817:Ptprb UTSW 10 116283677 small deletion probably benign
R6826:Ptprb UTSW 10 116317372 missense probably benign 0.26
R6958:Ptprb UTSW 10 116277248 missense probably benign 0.32
R7103:Ptprb UTSW 10 116338813 missense probably damaging 1.00
R7129:Ptprb UTSW 10 116283677 small deletion probably benign
R7181:Ptprb UTSW 10 116368766 missense probably damaging 1.00
R7215:Ptprb UTSW 10 116338776 missense possibly damaging 0.94
R7289:Ptprb UTSW 10 116328165 missense probably damaging 0.99
R7315:Ptprb UTSW 10 116362379 missense possibly damaging 0.83
R7319:Ptprb UTSW 10 116341404 missense probably benign 0.01
R7381:Ptprb UTSW 10 116341133 missense probably benign
R7412:Ptprb UTSW 10 116341138 missense probably benign
R7483:Ptprb UTSW 10 116283429 missense probably benign 0.01
R7495:Ptprb UTSW 10 116341448 missense probably benign 0.12
R7508:Ptprb UTSW 10 116353991 nonsense probably null
R7571:Ptprb UTSW 10 116339430 missense probably damaging 1.00
R7586:Ptprb UTSW 10 116343874 missense probably damaging 0.97
R7623:Ptprb UTSW 10 116369309 missense possibly damaging 0.63
R7694:Ptprb UTSW 10 116372948 missense probably damaging 1.00
R7744:Ptprb UTSW 10 116277484 missense probably benign 0.10
R7752:Ptprb UTSW 10 116369428 missense probably benign 0.37
R7826:Ptprb UTSW 10 116283677 small deletion probably benign
R7834:Ptprb UTSW 10 116339424 missense probably benign 0.00
R7846:Ptprb UTSW 10 116283548 missense probably benign 0.17
R7896:Ptprb UTSW 10 116369457 splice site probably null
R7901:Ptprb UTSW 10 116369428 missense probably benign 0.37
R7912:Ptprb UTSW 10 116322487 missense probably damaging 1.00
R7941:Ptprb UTSW 10 116283677 small deletion probably benign
R8147:Ptprb UTSW 10 116317378 missense probably damaging 1.00
R8202:Ptprb UTSW 10 116353845 missense probably damaging 1.00
R8339:Ptprb UTSW 10 116283451 missense probably benign 0.14
R8400:Ptprb UTSW 10 116283572 small deletion probably benign
R8504:Ptprb UTSW 10 116341031 missense probably benign 0.27
R8679:Ptprb UTSW 10 116367590 missense probably damaging 1.00
R8786:Ptprb UTSW 10 116319401 missense probably benign 0.40
R8914:Ptprb UTSW 10 116322662 nonsense probably null
RF041:Ptprb UTSW 10 116283677 small deletion probably benign
X0020:Ptprb UTSW 10 116302180 missense possibly damaging 0.62
Z1176:Ptprb UTSW 10 116302156 frame shift probably null
Z1177:Ptprb UTSW 10 116362642 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGAAAGATCTTGGCATTTCCCC -3'
(R):5'- AGCGATTCATTTCTCTTCACGAAG -3'

Sequencing Primer
(F):5'- GAAAGATCTTGGCATTTCCCCCAATC -3'
(R):5'- CACGAAGATGGATAAATGTTAACGTC -3'
Posted On2019-12-20