Incidental Mutation 'R7833:Or3a1b'
ID 605792
Institutional Source Beutler Lab
Gene Symbol Or3a1b
Ensembl Gene ENSMUSG00000070380
Gene Name olfactory receptor family 3 subfamily A member 1B
Synonyms GA_x6K02T2P1NL-4278037-4278984, Olfr401, MOR255-6
MMRRC Submission 045887-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R7833 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 74012117-74013064 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 74012663 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 183 (D183N)
Ref Sequence ENSEMBL: ENSMUSP00000149542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079827] [ENSMUST00000213754]
AlphaFold Q8VFX6
Predicted Effect probably damaging
Transcript: ENSMUST00000079827
AA Change: D183N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078756
Gene: ENSMUSG00000070380
AA Change: D183N

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 9.4e-51 PFAM
Pfam:7tm_1 44 293 2.2e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213754
AA Change: D183N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2987 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,902,059 (GRCm39) S578T possibly damaging Het
Acot5 A G 12: 84,122,601 (GRCm39) Q395R probably damaging Het
Adamts15 T A 9: 30,833,401 (GRCm39) T45S probably benign Het
Agbl2 A G 2: 90,645,777 (GRCm39) K837E probably benign Het
Atf2 T C 2: 73,684,229 (GRCm39) T19A possibly damaging Het
Atp6v0a2 T C 5: 124,782,969 (GRCm39) V238A probably damaging Het
Atp9a A T 2: 168,516,777 (GRCm39) V430E probably benign Het
Cachd1 G A 4: 100,832,012 (GRCm39) V725I probably benign Het
Ccnb1 G A 13: 100,917,859 (GRCm39) T247M probably damaging Het
Cd40 A T 2: 164,908,431 (GRCm39) D169V probably benign Het
Cdc25c G A 18: 34,880,296 (GRCm39) T146I probably benign Het
Cdhr18 A T 14: 13,896,968 (GRCm38) probably null Het
Ceacam3 C A 7: 16,893,778 (GRCm39) Q430K Het
Cerkl G A 2: 79,171,724 (GRCm39) T378I probably benign Het
Cpn2 G T 16: 30,079,163 (GRCm39) N179K probably damaging Het
Duox1 A G 2: 122,154,869 (GRCm39) D418G probably damaging Het
Eif1ad13 G A 12: 87,762,322 (GRCm39) R14K unknown Het
Eps8l1 C A 7: 4,471,866 (GRCm39) P11T possibly damaging Het
Erc1 C T 6: 119,801,447 (GRCm39) W190* probably null Het
Exosc7 A T 9: 122,959,984 (GRCm39) E195V probably benign Het
F2rl2 A G 13: 95,837,426 (GRCm39) N157S probably damaging Het
Fgd2 T C 17: 29,586,369 (GRCm39) L270P possibly damaging Het
Fitm2 A T 2: 163,312,019 (GRCm39) W65R probably damaging Het
Gabbr1 T G 17: 37,367,861 (GRCm39) I437S possibly damaging Het
Galntl6 A T 8: 58,310,571 (GRCm39) S377T probably benign Het
Gml2 T A 15: 74,693,217 (GRCm39) C73* probably null Het
Htr6 G T 4: 138,789,142 (GRCm39) F304L probably damaging Het
Hydin G A 8: 111,316,092 (GRCm39) G4328D probably damaging Het
Kcnj14 T C 7: 45,467,317 (GRCm39) D343G probably damaging Het
Klhdc1 T A 12: 69,329,942 (GRCm39) I357N probably benign Het
Lcor A G 19: 41,573,024 (GRCm39) D593G probably benign Het
Man2a1 A G 17: 64,973,746 (GRCm39) T341A probably damaging Het
Mrm1 A C 11: 84,709,469 (GRCm39) V196G probably damaging Het
Mybbp1a A G 11: 72,333,727 (GRCm39) probably null Het
Myo19 G A 11: 84,800,093 (GRCm39) C826Y probably benign Het
Nbea A G 3: 55,910,218 (GRCm39) W1326R probably damaging Het
Notch1 A G 2: 26,349,545 (GRCm39) *2532Q probably null Het
Npas2 A G 1: 39,365,228 (GRCm39) Y287C probably damaging Het
Or9g20 T A 2: 85,630,293 (GRCm39) D107V probably benign Het
Pate7 T A 9: 35,688,406 (GRCm39) S60C probably damaging Het
Pcdhga7 C A 18: 37,849,077 (GRCm39) D361E possibly damaging Het
Pde10a T A 17: 9,180,752 (GRCm39) Y447N possibly damaging Het
Piwil2 T A 14: 70,632,890 (GRCm39) I561F probably benign Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Ppp4r4 A G 12: 103,564,407 (GRCm39) T591A probably benign Het
Prxl2c T C 13: 64,460,092 (GRCm39) S84G probably benign Het
Ptprb A G 10: 116,151,156 (GRCm39) T273A probably benign Het
Ptpro T A 6: 137,393,861 (GRCm39) L843* probably null Het
Qrfpr T C 3: 36,243,751 (GRCm39) I117V probably benign Het
Qrich2 T C 11: 116,346,591 (GRCm39) D1411G probably benign Het
Rad51ap2 T C 12: 11,506,656 (GRCm39) S193P probably benign Het
Raver1 T C 9: 20,992,610 (GRCm39) E273G probably benign Het
Rubcn C A 16: 32,688,644 (GRCm39) probably benign Het
S1pr4 C T 10: 81,334,326 (GRCm39) V383I possibly damaging Het
Scn7a T C 2: 66,506,494 (GRCm39) D1465G probably damaging Het
Smarca4 T A 9: 21,558,655 (GRCm39) D607E possibly damaging Het
Srbd1 T A 17: 86,292,882 (GRCm39) I896L possibly damaging Het
Sulf2 G T 2: 165,921,456 (GRCm39) N722K possibly damaging Het
Surf1 A G 2: 26,806,280 (GRCm39) Y22H probably benign Het
Syngr2 A G 11: 117,703,982 (GRCm39) T150A probably benign Het
Szt2 G T 4: 118,223,416 (GRCm39) H3056N unknown Het
Tmf1 A T 6: 97,138,372 (GRCm39) S849T probably benign Het
Tns1 T A 1: 74,130,490 (GRCm39) probably benign Het
Trio G T 15: 27,774,172 (GRCm39) P1764Q probably damaging Het
Trpc3 A T 3: 36,694,821 (GRCm39) V711D probably damaging Het
Ttll3 G T 6: 113,386,298 (GRCm39) K710N probably damaging Het
Unc13c A G 9: 73,388,391 (GRCm39) S2132P possibly damaging Het
Utp20 G A 10: 88,636,998 (GRCm39) P738S possibly damaging Het
Vmn2r76 C T 7: 85,877,892 (GRCm39) V502I probably benign Het
Vsig1 C T X: 139,833,875 (GRCm39) H232Y probably benign Het
Wdr64 T G 1: 175,591,511 (GRCm39) F390V probably damaging Het
Ybx3 T G 6: 131,344,826 (GRCm39) T341P possibly damaging Het
Zdhhc11 C A 13: 74,121,866 (GRCm39) Q126K possibly damaging Het
Zfp777 G A 6: 48,002,072 (GRCm39) P673S probably damaging Het
Other mutations in Or3a1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Or3a1b APN 11 74,012,705 (GRCm39) missense probably benign 0.00
IGL01303:Or3a1b APN 11 74,012,160 (GRCm39) missense probably damaging 1.00
IGL01397:Or3a1b APN 11 74,012,590 (GRCm39) missense probably damaging 0.97
IGL02101:Or3a1b APN 11 74,012,571 (GRCm39) nonsense probably null
IGL02121:Or3a1b APN 11 74,012,113 (GRCm39) splice site probably benign
IGL02347:Or3a1b APN 11 74,012,397 (GRCm39) missense probably benign 0.03
IGL03113:Or3a1b APN 11 74,012,529 (GRCm39) missense probably benign 0.13
IGL03126:Or3a1b APN 11 74,012,610 (GRCm39) missense probably benign 0.01
IGL03302:Or3a1b APN 11 74,012,459 (GRCm39) missense possibly damaging 0.60
R0549:Or3a1b UTSW 11 74,012,301 (GRCm39) missense probably damaging 1.00
R1180:Or3a1b UTSW 11 74,012,406 (GRCm39) missense probably benign 0.28
R1350:Or3a1b UTSW 11 74,013,039 (GRCm39) missense possibly damaging 0.96
R1800:Or3a1b UTSW 11 74,012,234 (GRCm39) missense probably benign 0.00
R1808:Or3a1b UTSW 11 74,012,257 (GRCm39) missense probably damaging 0.96
R1962:Or3a1b UTSW 11 74,012,650 (GRCm39) missense probably benign 0.02
R1998:Or3a1b UTSW 11 74,012,406 (GRCm39) missense probably benign 0.28
R1999:Or3a1b UTSW 11 74,012,406 (GRCm39) missense probably benign 0.28
R2000:Or3a1b UTSW 11 74,012,406 (GRCm39) missense probably benign 0.28
R2859:Or3a1b UTSW 11 74,012,808 (GRCm39) missense probably damaging 1.00
R4914:Or3a1b UTSW 11 74,012,705 (GRCm39) missense probably benign 0.00
R4915:Or3a1b UTSW 11 74,012,705 (GRCm39) missense probably benign 0.00
R4916:Or3a1b UTSW 11 74,012,705 (GRCm39) missense probably benign 0.00
R4918:Or3a1b UTSW 11 74,012,705 (GRCm39) missense probably benign 0.00
R5292:Or3a1b UTSW 11 74,012,877 (GRCm39) missense probably damaging 0.99
R5522:Or3a1b UTSW 11 74,012,484 (GRCm39) missense probably damaging 1.00
R5761:Or3a1b UTSW 11 74,012,335 (GRCm39) missense probably damaging 0.97
R6318:Or3a1b UTSW 11 74,012,547 (GRCm39) missense possibly damaging 0.82
R6608:Or3a1b UTSW 11 74,012,454 (GRCm39) missense probably benign 0.00
R6737:Or3a1b UTSW 11 74,012,732 (GRCm39) missense probably benign
R6790:Or3a1b UTSW 11 74,012,427 (GRCm39) missense probably damaging 1.00
R7243:Or3a1b UTSW 11 74,012,559 (GRCm39) missense probably damaging 0.97
R7423:Or3a1b UTSW 11 74,012,811 (GRCm39) missense probably benign 0.01
R7517:Or3a1b UTSW 11 74,012,335 (GRCm39) missense probably damaging 0.97
R8241:Or3a1b UTSW 11 74,013,035 (GRCm39) missense probably benign 0.03
R8423:Or3a1b UTSW 11 74,012,492 (GRCm39) missense probably benign 0.06
R8937:Or3a1b UTSW 11 74,012,874 (GRCm39) missense probably benign 0.03
R9145:Or3a1b UTSW 11 74,012,526 (GRCm39) missense probably benign 0.01
R9725:Or3a1b UTSW 11 74,012,612 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTTCTTGTTGACAGCCATGG -3'
(R):5'- ATGGCAACCACAGTGAGGTG -3'

Sequencing Primer
(F):5'- ATGGCTTACGACCGCTTCCTAG -3'
(R):5'- AGCTGCATGTGGAGAAAGCTTTC -3'
Posted On 2019-12-20