Incidental Mutation 'R0086:Scnn1a'
ID60580
Institutional Source Beutler Lab
Gene Symbol Scnn1a
Ensembl Gene ENSMUSG00000030340
Gene Namesodium channel, nonvoltage-gated 1 alpha
SynonymsENaC alpha, mENaC, Scnn1
MMRRC Submission 038373-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0086 (G1)
Quality Score131
Status Validated
Chromosome6
Chromosomal Location125320659-125344943 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 125342587 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081440] [ENSMUST00000175966] [ENSMUST00000176110] [ENSMUST00000176442] [ENSMUST00000176655] [ENSMUST00000177329]
Predicted Effect probably benign
Transcript: ENSMUST00000081440
SMART Domains Protein: ENSMUSP00000080164
Gene: ENSMUSG00000030340

DomainStartEndE-ValueType
low complexity region 13 18 N/A INTRINSIC
Pfam:ASC 88 600 1.1e-93 PFAM
low complexity region 647 677 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175966
SMART Domains Protein: ENSMUSP00000135551
Gene: ENSMUSG00000030340

DomainStartEndE-ValueType
Pfam:ASC 62 264 3.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176110
SMART Domains Protein: ENSMUSP00000134940
Gene: ENSMUSG00000030340

DomainStartEndE-ValueType
Pfam:ASC 62 575 1.9e-112 PFAM
low complexity region 621 651 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176442
SMART Domains Protein: ENSMUSP00000135336
Gene: ENSMUSG00000030340

DomainStartEndE-ValueType
Pfam:ASC 1 494 6.3e-105 PFAM
low complexity region 540 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176655
SMART Domains Protein: ENSMUSP00000135798
Gene: ENSMUSG00000030340

DomainStartEndE-ValueType
Pfam:ASC 1 494 6.4e-105 PFAM
low complexity region 540 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177329
SMART Domains Protein: ENSMUSP00000134929
Gene: ENSMUSG00000030340

DomainStartEndE-ValueType
Pfam:ASC 62 575 1.9e-112 PFAM
low complexity region 621 651 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.0%
  • 10x: 94.6%
  • 20x: 86.6%
Validation Efficiency 96% (91/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nonvoltage-gated, amiloride-sensitive, sodium channels control fluid and electrolyte transport across epithelia in many organs. These channels are heteromeric complexes consisting of 3 subunits: alpha, beta, and gamma. This gene encodes the alpha subunit, and mutations in this gene have been associated with pseudohypoaldosteronism type 1 (PHA1), a rare salt wasting disease resulting from target organ unresponsiveness to mineralocorticoids. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit skin with epithelial hyperplasia, abnormal nuclei, premature lipid secretion, and abnormal keratohyaline granules. Mutants die within 40 hours of birth due to inability to clear their lungs of liquid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,062,601 V233D probably benign Het
Abcg8 T C 17: 84,692,771 V252A probably damaging Het
Adam39 C T 8: 40,826,360 T596I possibly damaging Het
Agap2 C A 10: 127,087,882 probably null Het
Ap4b1 T G 3: 103,814,860 V50G probably damaging Het
Atp13a1 T A 8: 69,797,774 I381N possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Birc6 T C 17: 74,593,166 V1113A possibly damaging Het
C1galt1 T A 6: 7,867,051 probably benign Het
Capza2 A G 6: 17,660,774 K158E probably damaging Het
Cenpe C T 3: 135,264,424 probably benign Het
Cercam T C 2: 29,871,064 L42P probably damaging Het
Cfap54 T C 10: 93,028,594 E807G possibly damaging Het
Cog6 A G 3: 52,993,570 V157A probably damaging Het
Cts6 A T 13: 61,196,457 probably benign Het
Cyp2c39 A T 19: 39,510,913 I15F unknown Het
Dock7 A T 4: 98,945,144 V1970D probably damaging Het
Exph5 A G 9: 53,337,930 D73G possibly damaging Het
Gjc2 A T 11: 59,176,846 M270K probably benign Het
Gns G A 10: 121,391,473 D463N probably damaging Het
Hoxd8 G T 2: 74,705,932 G129W probably damaging Het
Ina A G 19: 47,023,591 T483A possibly damaging Het
Lmod3 T A 6: 97,247,345 Q505L probably damaging Het
Map3k13 A G 16: 21,914,225 N526D probably damaging Het
Map3k2 A T 18: 32,218,468 I435F probably damaging Het
Mfsd6l A G 11: 68,556,565 T81A probably benign Het
Micall1 T C 15: 79,125,489 probably benign Het
Mkrn2 G T 6: 115,613,335 M217I possibly damaging Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Ncapg A G 5: 45,676,744 probably null Het
Nlrp9a G A 7: 26,558,547 C530Y probably damaging Het
Numb T C 12: 83,795,930 T442A probably damaging Het
Oip5 C T 2: 119,617,929 probably benign Het
Olfr1224-ps1 C T 2: 89,156,476 R233H probably benign Het
Olfr342 A T 2: 36,527,450 I13F possibly damaging Het
Olfr639 A G 7: 104,012,054 I216T probably benign Het
Olfr936 T C 9: 39,046,895 T175A probably benign Het
Pcnx T C 12: 81,992,058 probably benign Het
Pkhd1l1 T A 15: 44,556,008 N2956K possibly damaging Het
Plcl1 T A 1: 55,715,583 W1030R probably damaging Het
Polr2i G A 7: 30,233,086 V73M probably damaging Het
Prr14l T A 5: 32,831,559 probably benign Het
Pxdn G T 12: 30,002,419 R865L possibly damaging Het
Shkbp1 G T 7: 27,352,026 H203N probably benign Het
Skiv2l2 G T 13: 112,927,328 F10L probably benign Het
Slc22a14 C T 9: 119,222,738 probably benign Het
Snap29 C A 16: 17,428,236 T240K probably damaging Het
Sp2 C A 11: 96,957,427 G457C probably damaging Het
Ssr2 C T 3: 88,576,880 probably benign Het
Synpo2 A T 3: 123,117,104 C297* probably null Het
Tpm3 T A 3: 90,090,092 probably benign Het
Trmt6 CTG C 2: 132,809,017 probably benign Het
Trp63 T C 16: 25,871,087 Y431H probably damaging Het
Tuba3b T A 6: 145,621,160 C376S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Ulk1 G A 5: 110,787,707 probably benign Het
Usp24 T C 4: 106,392,360 S1425P probably damaging Het
Xdh T C 17: 73,884,438 I1335V probably benign Het
Zmynd15 T C 11: 70,464,232 Y352H probably damaging Het
Other mutations in Scnn1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Scnn1a APN 6 125338379 missense probably benign 0.11
IGL01793:Scnn1a APN 6 125343703 missense probably benign 0.03
IGL01992:Scnn1a APN 6 125338937 critical splice donor site probably null
IGL03280:Scnn1a APN 6 125342781 splice site probably benign
R0442:Scnn1a UTSW 6 125339137 missense probably damaging 1.00
R0454:Scnn1a UTSW 6 125322226 missense probably damaging 1.00
R0578:Scnn1a UTSW 6 125322244 missense probably damaging 0.97
R1538:Scnn1a UTSW 6 125338893 missense possibly damaging 0.48
R1579:Scnn1a UTSW 6 125322140 missense probably damaging 1.00
R1803:Scnn1a UTSW 6 125332194 missense probably damaging 0.98
R1876:Scnn1a UTSW 6 125338838 missense probably benign 0.05
R2113:Scnn1a UTSW 6 125337811 missense possibly damaging 0.60
R2178:Scnn1a UTSW 6 125331002 missense probably damaging 0.96
R2960:Scnn1a UTSW 6 125322293 missense probably damaging 1.00
R4072:Scnn1a UTSW 6 125338907 missense probably damaging 1.00
R4603:Scnn1a UTSW 6 125322160 missense probably damaging 1.00
R4928:Scnn1a UTSW 6 125322173 missense probably damaging 1.00
R5436:Scnn1a UTSW 6 125343022 missense possibly damaging 0.94
R6812:Scnn1a UTSW 6 125337856 missense probably benign 0.09
R7089:Scnn1a UTSW 6 125337807 missense probably benign 0.05
X0026:Scnn1a UTSW 6 125322110 missense probably damaging 1.00
Z1176:Scnn1a UTSW 6 125343892 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AACGCCTTTATTATGCAACCATTGTTCC -3'
(R):5'- GCAGAGAGCTTGTAGTTGGTCACAC -3'

Sequencing Primer
(F):5'- GCAACCATTGTTCCCATTTTTTTTC -3'
(R):5'- TGCAGACAGATAAGAGTGCTTAGTG -3'
Posted On2013-07-24