Incidental Mutation 'R7833:Ppp4r4'
ID 605801
Institutional Source Beutler Lab
Gene Symbol Ppp4r4
Ensembl Gene ENSMUSG00000021209
Gene Name protein phosphatase 4, regulatory subunit 4
Synonyms 8430415E04Rik
MMRRC Submission 045887-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.154) question?
Stock # R7833 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 103498542-103580090 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103564407 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 591 (T591A)
Ref Sequence ENSEMBL: ENSMUSP00000021631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021631] [ENSMUST00000187155] [ENSMUST00000189871] [ENSMUST00000190151]
AlphaFold Q8C0Y0
Predicted Effect probably benign
Transcript: ENSMUST00000021631
AA Change: T591A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000021631
Gene: ENSMUSG00000021209
AA Change: T591A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 55 577 6e-27 SMART
PDB:3FGA|A 178 666 8e-6 PDB
coiled coil region 690 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187155
AA Change: T482A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000140874
Gene: ENSMUSG00000021209
AA Change: T482A

DomainStartEndE-ValueType
Pfam:HEAT 145 175 2.8e-3 PFAM
low complexity region 484 495 N/A INTRINSIC
coiled coil region 581 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189871
AA Change: T591A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000139786
Gene: ENSMUSG00000021209
AA Change: T591A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 95 577 7e-26 SMART
PDB:1B3U|B 178 666 2e-6 PDB
coiled coil region 690 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190151
SMART Domains Protein: ENSMUSP00000139815
Gene: ENSMUSG00000021209

DomainStartEndE-ValueType
low complexity region 99 114 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a HEAT-like repeat-containing protein. The HEAT repeat is a tandemly repeated, 37-47 amino acid long module occurring in a number of cytoplasmic proteins. Arrays of HEAT repeats form a rod-like helical structure and appear to function as protein-protein interaction surfaces. The repeat-containing region of this protein has some similarity to the constant regulatory domain of the protein phosphatase 2A PR65/A subunit. The encoded protein binds protein serine/threonine phosphatase 4c in the cytoplasm. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,902,059 (GRCm39) S578T possibly damaging Het
Acot5 A G 12: 84,122,601 (GRCm39) Q395R probably damaging Het
Adamts15 T A 9: 30,833,401 (GRCm39) T45S probably benign Het
Agbl2 A G 2: 90,645,777 (GRCm39) K837E probably benign Het
Atf2 T C 2: 73,684,229 (GRCm39) T19A possibly damaging Het
Atp6v0a2 T C 5: 124,782,969 (GRCm39) V238A probably damaging Het
Atp9a A T 2: 168,516,777 (GRCm39) V430E probably benign Het
Cachd1 G A 4: 100,832,012 (GRCm39) V725I probably benign Het
Ccnb1 G A 13: 100,917,859 (GRCm39) T247M probably damaging Het
Cd40 A T 2: 164,908,431 (GRCm39) D169V probably benign Het
Cdc25c G A 18: 34,880,296 (GRCm39) T146I probably benign Het
Cdhr18 A T 14: 13,896,968 (GRCm38) probably null Het
Ceacam3 C A 7: 16,893,778 (GRCm39) Q430K Het
Cerkl G A 2: 79,171,724 (GRCm39) T378I probably benign Het
Cpn2 G T 16: 30,079,163 (GRCm39) N179K probably damaging Het
Duox1 A G 2: 122,154,869 (GRCm39) D418G probably damaging Het
Eif1ad13 G A 12: 87,762,322 (GRCm39) R14K unknown Het
Eps8l1 C A 7: 4,471,866 (GRCm39) P11T possibly damaging Het
Erc1 C T 6: 119,801,447 (GRCm39) W190* probably null Het
Exosc7 A T 9: 122,959,984 (GRCm39) E195V probably benign Het
F2rl2 A G 13: 95,837,426 (GRCm39) N157S probably damaging Het
Fgd2 T C 17: 29,586,369 (GRCm39) L270P possibly damaging Het
Fitm2 A T 2: 163,312,019 (GRCm39) W65R probably damaging Het
Gabbr1 T G 17: 37,367,861 (GRCm39) I437S possibly damaging Het
Galntl6 A T 8: 58,310,571 (GRCm39) S377T probably benign Het
Gml2 T A 15: 74,693,217 (GRCm39) C73* probably null Het
Htr6 G T 4: 138,789,142 (GRCm39) F304L probably damaging Het
Hydin G A 8: 111,316,092 (GRCm39) G4328D probably damaging Het
Kcnj14 T C 7: 45,467,317 (GRCm39) D343G probably damaging Het
Klhdc1 T A 12: 69,329,942 (GRCm39) I357N probably benign Het
Lcor A G 19: 41,573,024 (GRCm39) D593G probably benign Het
Man2a1 A G 17: 64,973,746 (GRCm39) T341A probably damaging Het
Mrm1 A C 11: 84,709,469 (GRCm39) V196G probably damaging Het
Mybbp1a A G 11: 72,333,727 (GRCm39) probably null Het
Myo19 G A 11: 84,800,093 (GRCm39) C826Y probably benign Het
Nbea A G 3: 55,910,218 (GRCm39) W1326R probably damaging Het
Notch1 A G 2: 26,349,545 (GRCm39) *2532Q probably null Het
Npas2 A G 1: 39,365,228 (GRCm39) Y287C probably damaging Het
Or3a1b G A 11: 74,012,663 (GRCm39) D183N probably damaging Het
Or9g20 T A 2: 85,630,293 (GRCm39) D107V probably benign Het
Pate7 T A 9: 35,688,406 (GRCm39) S60C probably damaging Het
Pcdhga7 C A 18: 37,849,077 (GRCm39) D361E possibly damaging Het
Pde10a T A 17: 9,180,752 (GRCm39) Y447N possibly damaging Het
Piwil2 T A 14: 70,632,890 (GRCm39) I561F probably benign Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Prxl2c T C 13: 64,460,092 (GRCm39) S84G probably benign Het
Ptprb A G 10: 116,151,156 (GRCm39) T273A probably benign Het
Ptpro T A 6: 137,393,861 (GRCm39) L843* probably null Het
Qrfpr T C 3: 36,243,751 (GRCm39) I117V probably benign Het
Qrich2 T C 11: 116,346,591 (GRCm39) D1411G probably benign Het
Rad51ap2 T C 12: 11,506,656 (GRCm39) S193P probably benign Het
Raver1 T C 9: 20,992,610 (GRCm39) E273G probably benign Het
Rubcn C A 16: 32,688,644 (GRCm39) probably benign Het
S1pr4 C T 10: 81,334,326 (GRCm39) V383I possibly damaging Het
Scn7a T C 2: 66,506,494 (GRCm39) D1465G probably damaging Het
Smarca4 T A 9: 21,558,655 (GRCm39) D607E possibly damaging Het
Srbd1 T A 17: 86,292,882 (GRCm39) I896L possibly damaging Het
Sulf2 G T 2: 165,921,456 (GRCm39) N722K possibly damaging Het
Surf1 A G 2: 26,806,280 (GRCm39) Y22H probably benign Het
Syngr2 A G 11: 117,703,982 (GRCm39) T150A probably benign Het
Szt2 G T 4: 118,223,416 (GRCm39) H3056N unknown Het
Tmf1 A T 6: 97,138,372 (GRCm39) S849T probably benign Het
Tns1 T A 1: 74,130,490 (GRCm39) probably benign Het
Trio G T 15: 27,774,172 (GRCm39) P1764Q probably damaging Het
Trpc3 A T 3: 36,694,821 (GRCm39) V711D probably damaging Het
Ttll3 G T 6: 113,386,298 (GRCm39) K710N probably damaging Het
Unc13c A G 9: 73,388,391 (GRCm39) S2132P possibly damaging Het
Utp20 G A 10: 88,636,998 (GRCm39) P738S possibly damaging Het
Vmn2r76 C T 7: 85,877,892 (GRCm39) V502I probably benign Het
Vsig1 C T X: 139,833,875 (GRCm39) H232Y probably benign Het
Wdr64 T G 1: 175,591,511 (GRCm39) F390V probably damaging Het
Ybx3 T G 6: 131,344,826 (GRCm39) T341P possibly damaging Het
Zdhhc11 C A 13: 74,121,866 (GRCm39) Q126K possibly damaging Het
Zfp777 G A 6: 48,002,072 (GRCm39) P673S probably damaging Het
Other mutations in Ppp4r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Ppp4r4 APN 12 103,545,335 (GRCm39) missense probably benign
IGL01388:Ppp4r4 APN 12 103,543,108 (GRCm39) missense probably damaging 1.00
IGL01662:Ppp4r4 APN 12 103,569,225 (GRCm39) missense possibly damaging 0.55
IGL01768:Ppp4r4 APN 12 103,547,664 (GRCm39) missense probably benign 0.12
IGL01894:Ppp4r4 APN 12 103,559,397 (GRCm39) missense probably damaging 1.00
IGL01921:Ppp4r4 APN 12 103,542,569 (GRCm39) start codon destroyed probably null 0.01
IGL01960:Ppp4r4 APN 12 103,547,753 (GRCm39) splice site probably benign
IGL02084:Ppp4r4 APN 12 103,566,657 (GRCm39) missense possibly damaging 0.93
IGL02287:Ppp4r4 APN 12 103,553,747 (GRCm39) missense probably benign 0.01
IGL02315:Ppp4r4 APN 12 103,566,620 (GRCm39) splice site probably benign
IGL03137:Ppp4r4 APN 12 103,547,643 (GRCm39) missense probably damaging 1.00
IGL03170:Ppp4r4 APN 12 103,557,033 (GRCm39) intron probably benign
cataract UTSW 12 103,579,074 (GRCm39) nonsense probably null
downfall UTSW 12 103,559,357 (GRCm39) missense probably benign 0.00
R0114:Ppp4r4 UTSW 12 103,542,633 (GRCm39) missense probably benign 0.00
R0390:Ppp4r4 UTSW 12 103,567,619 (GRCm39) splice site probably benign
R0403:Ppp4r4 UTSW 12 103,550,361 (GRCm39) missense probably benign
R0548:Ppp4r4 UTSW 12 103,579,074 (GRCm39) nonsense probably null
R0601:Ppp4r4 UTSW 12 103,566,779 (GRCm39) splice site probably benign
R0894:Ppp4r4 UTSW 12 103,566,754 (GRCm39) missense probably damaging 0.99
R1127:Ppp4r4 UTSW 12 103,545,327 (GRCm39) missense probably damaging 1.00
R1177:Ppp4r4 UTSW 12 103,542,582 (GRCm39) missense possibly damaging 0.82
R1378:Ppp4r4 UTSW 12 103,547,751 (GRCm39) splice site probably benign
R1442:Ppp4r4 UTSW 12 103,564,504 (GRCm39) missense probably damaging 0.97
R1497:Ppp4r4 UTSW 12 103,573,204 (GRCm39) missense probably benign 0.07
R1651:Ppp4r4 UTSW 12 103,550,331 (GRCm39) missense probably benign 0.01
R1797:Ppp4r4 UTSW 12 103,564,410 (GRCm39) missense possibly damaging 0.95
R1880:Ppp4r4 UTSW 12 103,571,294 (GRCm39) missense possibly damaging 0.62
R2008:Ppp4r4 UTSW 12 103,552,016 (GRCm39) missense probably damaging 1.00
R2038:Ppp4r4 UTSW 12 103,542,539 (GRCm39) critical splice acceptor site probably null
R2404:Ppp4r4 UTSW 12 103,547,749 (GRCm39) splice site probably null
R2696:Ppp4r4 UTSW 12 103,547,653 (GRCm39) missense possibly damaging 0.77
R2849:Ppp4r4 UTSW 12 103,573,192 (GRCm39) missense probably benign 0.00
R2965:Ppp4r4 UTSW 12 103,579,080 (GRCm39) missense probably damaging 1.00
R3030:Ppp4r4 UTSW 12 103,573,215 (GRCm39) missense probably benign
R3805:Ppp4r4 UTSW 12 103,566,625 (GRCm39) missense probably damaging 0.99
R3862:Ppp4r4 UTSW 12 103,562,680 (GRCm39) nonsense probably null
R4194:Ppp4r4 UTSW 12 103,524,704 (GRCm39) missense probably damaging 1.00
R4320:Ppp4r4 UTSW 12 103,564,502 (GRCm39) missense probably damaging 1.00
R4558:Ppp4r4 UTSW 12 103,573,192 (GRCm39) missense probably benign 0.00
R4783:Ppp4r4 UTSW 12 103,557,117 (GRCm39) critical splice donor site probably null
R4866:Ppp4r4 UTSW 12 103,566,706 (GRCm39) missense possibly damaging 0.92
R4903:Ppp4r4 UTSW 12 103,557,030 (GRCm39) splice site probably null
R5309:Ppp4r4 UTSW 12 103,573,147 (GRCm39) splice site probably null
R5312:Ppp4r4 UTSW 12 103,573,147 (GRCm39) splice site probably null
R5381:Ppp4r4 UTSW 12 103,559,357 (GRCm39) missense probably benign 0.00
R5383:Ppp4r4 UTSW 12 103,550,427 (GRCm39) missense probably benign 0.14
R5447:Ppp4r4 UTSW 12 103,550,410 (GRCm39) missense possibly damaging 0.67
R5942:Ppp4r4 UTSW 12 103,553,706 (GRCm39) missense possibly damaging 0.92
R6339:Ppp4r4 UTSW 12 103,571,228 (GRCm39) nonsense probably null
R6386:Ppp4r4 UTSW 12 103,559,364 (GRCm39) missense probably damaging 1.00
R6712:Ppp4r4 UTSW 12 103,562,702 (GRCm39) missense probably damaging 1.00
R6755:Ppp4r4 UTSW 12 103,551,996 (GRCm39) missense probably damaging 1.00
R6868:Ppp4r4 UTSW 12 103,557,111 (GRCm39) missense probably damaging 1.00
R6879:Ppp4r4 UTSW 12 103,518,179 (GRCm39) splice site probably null
R7355:Ppp4r4 UTSW 12 103,570,841 (GRCm39) nonsense probably null
R7397:Ppp4r4 UTSW 12 103,579,065 (GRCm39) critical splice acceptor site probably null
R7447:Ppp4r4 UTSW 12 103,551,985 (GRCm39) missense possibly damaging 0.46
R7576:Ppp4r4 UTSW 12 103,562,708 (GRCm39) missense probably damaging 0.97
R7653:Ppp4r4 UTSW 12 103,550,404 (GRCm39) missense probably damaging 0.98
R7683:Ppp4r4 UTSW 12 103,553,364 (GRCm39) nonsense probably null
R7748:Ppp4r4 UTSW 12 103,571,320 (GRCm39) critical splice donor site probably null
R7831:Ppp4r4 UTSW 12 103,557,080 (GRCm39) missense possibly damaging 0.76
R8238:Ppp4r4 UTSW 12 103,557,066 (GRCm39) missense probably benign 0.20
R8559:Ppp4r4 UTSW 12 103,559,420 (GRCm39) missense probably benign 0.04
R8674:Ppp4r4 UTSW 12 103,562,720 (GRCm39) missense probably damaging 0.97
R8799:Ppp4r4 UTSW 12 103,567,623 (GRCm39) missense possibly damaging 0.60
R8847:Ppp4r4 UTSW 12 103,562,747 (GRCm39) missense probably damaging 1.00
R8968:Ppp4r4 UTSW 12 103,566,706 (GRCm39) missense probably benign 0.00
R9075:Ppp4r4 UTSW 12 103,570,290 (GRCm39) nonsense probably null
R9106:Ppp4r4 UTSW 12 103,570,315 (GRCm39) missense probably benign 0.01
R9393:Ppp4r4 UTSW 12 103,571,296 (GRCm39) nonsense probably null
R9508:Ppp4r4 UTSW 12 103,542,561 (GRCm39) missense possibly damaging 0.65
R9520:Ppp4r4 UTSW 12 103,500,378 (GRCm39) missense probably benign 0.00
R9636:Ppp4r4 UTSW 12 103,564,688 (GRCm39) missense unknown
R9641:Ppp4r4 UTSW 12 103,567,811 (GRCm39) missense probably benign 0.15
R9765:Ppp4r4 UTSW 12 103,550,346 (GRCm39) nonsense probably null
R9766:Ppp4r4 UTSW 12 103,562,735 (GRCm39) missense probably benign 0.40
X0025:Ppp4r4 UTSW 12 103,566,739 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTCAGTCATCACAGGTCGTC -3'
(R):5'- GGGGTTTGCAAATGTTTACCAC -3'

Sequencing Primer
(F):5'- GGCATTGATTCAGTAGAGTAATACC -3'
(R):5'- GGGTTTGCAAATGTTTACCACAATGG -3'
Posted On 2019-12-20