Incidental Mutation 'R7833:Pcdhga7'
ID 605818
Institutional Source Beutler Lab
Gene Symbol Pcdhga7
Ensembl Gene ENSMUSG00000103472
Gene Name protocadherin gamma subfamily A, 7
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.147) question?
Stock # R7833 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 37714764-37841873 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 37716024 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 361 (D361E)
Ref Sequence ENSEMBL: ENSMUSP00000141704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073447] [ENSMUST00000115661] [ENSMUST00000192511] [ENSMUST00000192931] [ENSMUST00000193414] [ENSMUST00000193476] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000194544] [ENSMUST00000195112] [ENSMUST00000195363] [ENSMUST00000195823]
AlphaFold Q6DD96
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000192511
AA Change: D361E

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141704
Gene: ENSMUSG00000103472
AA Change: D361E

DomainStartEndE-ValueType
CA 47 133 1.57e-2 SMART
CA 157 242 3.24e-19 SMART
CA 266 347 3.21e-23 SMART
CA 371 452 9.08e-23 SMART
CA 476 562 1.32e-24 SMART
CA 593 671 3.5e-15 SMART
transmembrane domain 694 716 N/A INTRINSIC
low complexity region 916 935 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193414
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193476
AA Change: D361E

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000142126
Gene: ENSMUSG00000103472
AA Change: D361E

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 47 133 7.6e-5 SMART
CA 157 242 1.6e-21 SMART
CA 266 347 1.6e-25 SMART
CA 371 452 4.5e-25 SMART
CA 476 562 6.6e-27 SMART
CA 593 671 1.7e-17 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195112
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195363
SMART Domains Protein: ENSMUSP00000142227
Gene: ENSMUSG00000103585

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 1.47e-2 SMART
CA 155 240 1.23e-19 SMART
CA 264 343 5.54e-27 SMART
CA 367 448 5.09e-26 SMART
CA 472 558 1.98e-23 SMART
CA 589 670 1.3e-9 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195823
SMART Domains Protein: ENSMUSP00000141803
Gene: ENSMUSG00000103793

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
CA 45 131 2.41e-2 SMART
CA 155 240 5.77e-16 SMART
CA 264 345 1.1e-21 SMART
CA 369 450 2.75e-22 SMART
low complexity region 453 462 N/A INTRINSIC
CA 474 560 9.22e-24 SMART
CA 591 669 2.4e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 T C 13: 64,312,278 S84G probably benign Het
Acin1 A T 14: 54,664,602 S578T possibly damaging Het
Acot5 A G 12: 84,075,827 Q395R probably damaging Het
Adamts15 T A 9: 30,922,105 T45S probably benign Het
Agbl2 A G 2: 90,815,433 K837E probably benign Het
Atf2 T C 2: 73,853,885 T19A possibly damaging Het
Atp6v0a2 T C 5: 124,645,031 V238A probably damaging Het
Atp9a A T 2: 168,674,857 V430E probably benign Het
Cachd1 G A 4: 100,974,815 V725I probably benign Het
Ccnb1 G A 13: 100,781,351 T247M probably damaging Het
Cd40 A T 2: 165,066,511 D169V probably benign Het
Cdc25c G A 18: 34,747,243 T146I probably benign Het
Ceacam3 C A 7: 17,159,853 Q430K Het
Cerkl G A 2: 79,341,380 T378I probably benign Het
Cpn2 G T 16: 30,260,345 N179K probably damaging Het
Duox1 A G 2: 122,324,388 D418G probably damaging Het
Eps8l1 C A 7: 4,468,867 P11T possibly damaging Het
Erc1 C T 6: 119,824,486 W190* probably null Het
Exosc7 A T 9: 123,130,919 E195V probably benign Het
F2rl2 A G 13: 95,700,918 N157S probably damaging Het
Fgd2 T C 17: 29,367,395 L270P possibly damaging Het
Fitm2 A T 2: 163,470,099 W65R probably damaging Het
Gabbr1 T G 17: 37,056,969 I437S possibly damaging Het
Galntl6 A T 8: 57,857,537 S377T probably benign Het
Gm17727 T A 9: 35,777,110 S60C probably damaging Het
Gm21936 G A 12: 87,795,552 R14K unknown Het
Gm281 A T 14: 13,896,968 probably null Het
Gm340 A G 19: 41,584,585 D593G probably benign Het
Gml2 T A 15: 74,821,368 C73* probably null Het
Htr6 G T 4: 139,061,831 F304L probably damaging Het
Hydin G A 8: 110,589,460 G4328D probably damaging Het
Kcnj14 T C 7: 45,817,893 D343G probably damaging Het
Klhdc1 T A 12: 69,283,168 I357N probably benign Het
Man2a1 A G 17: 64,666,751 T341A probably damaging Het
Mrm1 A C 11: 84,818,643 V196G probably damaging Het
Mybbp1a A G 11: 72,442,901 probably null Het
Myo19 G A 11: 84,909,267 C826Y probably benign Het
Nbea A G 3: 56,002,797 W1326R probably damaging Het
Notch1 A G 2: 26,459,533 *2532Q probably null Het
Npas2 A G 1: 39,326,147 Y287C probably damaging Het
Olfr1016 T A 2: 85,799,949 D107V probably benign Het
Olfr401 G A 11: 74,121,837 D183N probably damaging Het
Pde10a T A 17: 8,961,920 Y447N possibly damaging Het
Piwil2 T A 14: 70,395,441 I561F probably benign Het
Pml C A 9: 58,234,685 R288L probably benign Het
Ppp4r4 A G 12: 103,598,148 T591A probably benign Het
Ptprb A G 10: 116,315,251 T273A probably benign Het
Ptpro T A 6: 137,416,863 L843* probably null Het
Qrfpr T C 3: 36,189,602 I117V probably benign Het
Qrich2 T C 11: 116,455,765 D1411G probably benign Het
Rad51ap2 T C 12: 11,456,655 S193P probably benign Het
Raver1 T C 9: 21,081,314 E273G probably benign Het
Rubcn C A 16: 32,868,274 probably benign Het
S1pr4 C T 10: 81,498,492 V383I possibly damaging Het
Scn7a T C 2: 66,676,150 D1465G probably damaging Het
Smarca4 T A 9: 21,647,359 D607E possibly damaging Het
Srbd1 T A 17: 85,985,454 I896L possibly damaging Het
Sulf2 G T 2: 166,079,536 N722K possibly damaging Het
Surf1 A G 2: 26,916,268 Y22H probably benign Het
Syngr2 A G 11: 117,813,156 T150A probably benign Het
Szt2 G T 4: 118,366,219 H3056N unknown Het
Tmf1 A T 6: 97,161,411 S849T probably benign Het
Tns1 T A 1: 74,091,331 probably benign Het
Trio G T 15: 27,774,086 P1764Q probably damaging Het
Trpc3 A T 3: 36,640,672 V711D probably damaging Het
Ttll3 G T 6: 113,409,337 K710N probably damaging Het
Unc13c A G 9: 73,481,109 S2132P possibly damaging Het
Utp20 G A 10: 88,801,136 P738S possibly damaging Het
Vmn2r76 C T 7: 86,228,684 V502I probably benign Het
Vsig1 C T X: 140,933,126 H232Y probably benign Het
Wdr64 T G 1: 175,763,945 F390V probably damaging Het
Ybx3 T G 6: 131,367,863 T341P possibly damaging Het
Zdhhc11 C A 13: 73,973,747 Q126K possibly damaging Het
Zfp777 G A 6: 48,025,138 P673S probably damaging Het
Other mutations in Pcdhga7
AlleleSourceChrCoordTypePredicted EffectPPH Score
micro UTSW 18 37717274 missense probably benign 0.04
milli UTSW 18 37716430 missense probably benign 0.27
R3012:Pcdhga7 UTSW 18 37715638 missense probably benign 0.01
R3950:Pcdhga7 UTSW 18 37716515 missense probably damaging 1.00
R4697:Pcdhga7 UTSW 18 37717208 missense probably damaging 1.00
R4985:Pcdhga7 UTSW 18 37715645 missense probably benign 0.02
R5073:Pcdhga7 UTSW 18 37715972 missense probably damaging 1.00
R5137:Pcdhga7 UTSW 18 37717380 missense probably damaging 0.99
R5424:Pcdhga7 UTSW 18 37715335 missense probably benign 0.07
R5534:Pcdhga7 UTSW 18 37716278 missense probably damaging 1.00
R5619:Pcdhga7 UTSW 18 37715747 missense probably benign 0.00
R5689:Pcdhga7 UTSW 18 37716683 missense probably damaging 1.00
R6200:Pcdhga7 UTSW 18 37716082 missense probably damaging 0.99
R6235:Pcdhga7 UTSW 18 37716430 missense probably benign 0.27
R6597:Pcdhga7 UTSW 18 37717006 missense probably benign 0.24
R6684:Pcdhga7 UTSW 18 37716050 missense probably damaging 1.00
R6714:Pcdhga7 UTSW 18 37717277 missense probably benign 0.00
R6810:Pcdhga7 UTSW 18 37715873 missense probably benign 0.24
R6920:Pcdhga7 UTSW 18 37715146 missense probably benign 0.00
R6922:Pcdhga7 UTSW 18 37715657 missense probably damaging 0.99
R7051:Pcdhga7 UTSW 18 37716941 missense probably damaging 1.00
R7072:Pcdhga7 UTSW 18 37717276 missense probably benign 0.01
R7265:Pcdhga7 UTSW 18 37716916 missense probably damaging 1.00
R7397:Pcdhga7 UTSW 18 37717274 missense probably benign 0.04
R7450:Pcdhga7 UTSW 18 37716026 missense probably benign 0.27
R7451:Pcdhga7 UTSW 18 37716004 missense possibly damaging 0.67
R7790:Pcdhga7 UTSW 18 37714943 start codon destroyed probably null 0.85
R7922:Pcdhga7 UTSW 18 37716173 missense probably benign 0.00
R7935:Pcdhga7 UTSW 18 37716509 missense possibly damaging 0.91
R8007:Pcdhga7 UTSW 18 37716893 missense probably benign 0.06
R8073:Pcdhga7 UTSW 18 37715345 missense probably damaging 1.00
R8724:Pcdhga7 UTSW 18 37715093 missense probably benign 0.02
R8962:Pcdhga7 UTSW 18 37715826 missense probably benign 0.01
R9191:Pcdhga7 UTSW 18 37715879 missense probably benign 0.00
R9684:Pcdhga7 UTSW 18 37715614 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAATATTCCATCTGAGCTCCCTGAC -3'
(R):5'- CATCTGTGGCCTTCAGTGTG -3'

Sequencing Primer
(F):5'- GAGAGCTGTCGACTTTAAAAGGTC -3'
(R):5'- CCTTCAGTGTGATGTTGTACACAGAC -3'
Posted On 2019-12-20