Mutagenetix > Incidental Mutation

Incidental Mutation 'R7833:Gm340'

605819

Institutional Source

Beutler Lab

Gene Symbol

Gm340

Ensembl Gene

ENSMUSG00000090673

Gene Name

predicted gene 340

Synonyms

LOC381224

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R7833 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

41582370-41586536 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41584585 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 593 (D593G)

Ref Sequence

ENSEMBL: ENSMUSP00000128083 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172371]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000172371
AA Change: D593G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000128083
Gene: ENSMUSG00000090673
AA Change: D593G

Domain	Start	End	E-Value	Type
low complexity region	10	17	N/A	INTRINSIC
low complexity region	438	450	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
low complexity region	768	779	N/A	INTRINSIC
Pfam:DUF4553	787	1241	9.7e-179	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (71/71)

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	T	C	13: 64,312,278	S84G	probably benign	Het
Acin1	A	T	14: 54,664,602	S578T	possibly damaging	Het
Acot5	A	G	12: 84,075,827	Q395R	probably damaging	Het
Adamts15	T	A	9: 30,922,105	T45S	probably benign	Het
Agbl2	A	G	2: 90,815,433	K837E	probably benign	Het
Atf2	T	C	2: 73,853,885	T19A	possibly damaging	Het
Atp6v0a2	T	C	5: 124,645,031	V238A	probably damaging	Het
Atp9a	A	T	2: 168,674,857	V430E	probably benign	Het
Cachd1	G	A	4: 100,974,815	V725I	probably benign	Het
Ccnb1	G	A	13: 100,781,351	T247M	probably damaging	Het
Cd40	A	T	2: 165,066,511	D169V	probably benign	Het
Cdc25c	G	A	18: 34,747,243	T146I	probably benign	Het
Ceacam3	C	A	7: 17,159,853	Q430K		Het
Cerkl	G	A	2: 79,341,380	T378I	probably benign	Het
Cpn2	G	T	16: 30,260,345	N179K	probably damaging	Het
Duox1	A	G	2: 122,324,388	D418G	probably damaging	Het
Eps8l1	C	A	7: 4,468,867	P11T	possibly damaging	Het
Erc1	C	T	6: 119,824,486	W190*	probably null	Het
Exosc7	A	T	9: 123,130,919	E195V	probably benign	Het
F2rl2	A	G	13: 95,700,918	N157S	probably damaging	Het
Fgd2	T	C	17: 29,367,395	L270P	possibly damaging	Het
Fitm2	A	T	2: 163,470,099	W65R	probably damaging	Het
Gabbr1	T	G	17: 37,056,969	I437S	possibly damaging	Het
Galntl6	A	T	8: 57,857,537	S377T	probably benign	Het
Gm17727	T	A	9: 35,777,110	S60C	probably damaging	Het
Gm21936	G	A	12: 87,795,552	R14K	unknown	Het
Gm281	A	T	14: 13,896,968		probably null	Het
Gml2	T	A	15: 74,821,368	C73*	probably null	Het
Htr6	G	T	4: 139,061,831	F304L	probably damaging	Het
Hydin	G	A	8: 110,589,460	G4328D	probably damaging	Het
Kcnj14	T	C	7: 45,817,893	D343G	probably damaging	Het
Klhdc1	T	A	12: 69,283,168	I357N	probably benign	Het
Man2a1	A	G	17: 64,666,751	T341A	probably damaging	Het
Mrm1	A	C	11: 84,818,643	V196G	probably damaging	Het
Mybbp1a	A	G	11: 72,442,901		probably null	Het
Myo19	G	A	11: 84,909,267	C826Y	probably benign	Het
Nbea	A	G	3: 56,002,797	W1326R	probably damaging	Het
Notch1	A	G	2: 26,459,533	*2532Q	probably null	Het
Npas2	A	G	1: 39,326,147	Y287C	probably damaging	Het
Olfr1016	T	A	2: 85,799,949	D107V	probably benign	Het
Olfr401	G	A	11: 74,121,837	D183N	probably damaging	Het
Pcdhga7	C	A	18: 37,716,024	D361E	possibly damaging	Het
Pde10a	T	A	17: 8,961,920	Y447N	possibly damaging	Het
Piwil2	T	A	14: 70,395,441	I561F	probably benign	Het
Pml	C	A	9: 58,234,685	R288L	probably benign	Het
Ppp4r4	A	G	12: 103,598,148	T591A	probably benign	Het
Ptprb	A	G	10: 116,315,251	T273A	probably benign	Het
Ptpro	T	A	6: 137,416,863	L843*	probably null	Het
Qrfpr	T	C	3: 36,189,602	I117V	probably benign	Het
Qrich2	T	C	11: 116,455,765	D1411G	probably benign	Het
Rad51ap2	T	C	12: 11,456,655	S193P	probably benign	Het
Raver1	T	C	9: 21,081,314	E273G	probably benign	Het
Rubcn	C	A	16: 32,868,274		probably benign	Het
S1pr4	C	T	10: 81,498,492	V383I	possibly damaging	Het
Scn7a	T	C	2: 66,676,150	D1465G	probably damaging	Het
Smarca4	T	A	9: 21,647,359	D607E	possibly damaging	Het
Srbd1	T	A	17: 85,985,454	I896L	possibly damaging	Het
Sulf2	G	T	2: 166,079,536	N722K	possibly damaging	Het
Surf1	A	G	2: 26,916,268	Y22H	probably benign	Het
Syngr2	A	G	11: 117,813,156	T150A	probably benign	Het
Szt2	G	T	4: 118,366,219	H3056N	unknown	Het
Tmf1	A	T	6: 97,161,411	S849T	probably benign	Het
Tns1	T	A	1: 74,091,331		probably benign	Het
Trio	G	T	15: 27,774,086	P1764Q	probably damaging	Het
Trpc3	A	T	3: 36,640,672	V711D	probably damaging	Het
Ttll3	G	T	6: 113,409,337	K710N	probably damaging	Het
Unc13c	A	G	9: 73,481,109	S2132P	possibly damaging	Het
Utp20	G	A	10: 88,801,136	P738S	possibly damaging	Het
Vmn2r76	C	T	7: 86,228,684	V502I	probably benign	Het
Vsig1	C	T	X: 140,933,126	H232Y	probably benign	Het
Wdr64	T	G	1: 175,763,945	F390V	probably damaging	Het
Ybx3	T	G	6: 131,367,863	T341P	possibly damaging	Het
Zdhhc11	C	A	13: 73,973,747	Q126K	possibly damaging	Het
Zfp777	G	A	6: 48,025,138	P673S	probably damaging	Het

Other mutations in Gm340

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
BB003:Gm340	UTSW	19	41582569	missense	probably benign
BB013:Gm340	UTSW	19	41582569	missense	probably benign
R0006:Gm340	UTSW	19	41584899	missense	probably benign	0.00
R0686:Gm340	UTSW	19	41582372	missense	possibly damaging	0.73
R1104:Gm340	UTSW	19	41586063	missense	probably damaging	0.99
R1278:Gm340	UTSW	19	41584683	missense	probably benign	0.07
R1606:Gm340	UTSW	19	41585074	missense	probably benign	0.35
R1833:Gm340	UTSW	19	41584948	missense	probably benign	0.00
R1905:Gm340	UTSW	19	41583574	missense	possibly damaging	0.73
R2697:Gm340	UTSW	19	41584027	missense	probably benign	0.43
R2881:Gm340	UTSW	19	41583049	missense	probably damaging	1.00
R4720:Gm340	UTSW	19	41585895	missense	probably benign	0.04
R4864:Gm340	UTSW	19	41585364	missense	probably benign
R4908:Gm340	UTSW	19	41584162	missense	probably benign	0.00
R5193:Gm340	UTSW	19	41582530	missense	probably damaging	1.00
R5215:Gm340	UTSW	19	41585932	missense	probably damaging	1.00
R5276:Gm340	UTSW	19	41585039	missense	probably damaging	0.98
R5319:Gm340	UTSW	19	41586352	missense	probably damaging	0.99
R5321:Gm340	UTSW	19	41585204	missense	probably damaging	1.00
R5432:Gm340	UTSW	19	41584603	missense	probably damaging	1.00
R5605:Gm340	UTSW	19	41582863	missense	probably damaging	1.00
R5941:Gm340	UTSW	19	41586400	missense	probably damaging	1.00
R6020:Gm340	UTSW	19	41583547	missense	possibly damaging	0.88
R6024:Gm340	UTSW	19	41583957	missense	possibly damaging	0.84
R6149:Gm340	UTSW	19	41585202	missense	probably damaging	1.00
R6260:Gm340	UTSW	19	41582370	missense	probably null	0.91
R6260:Gm340	UTSW	19	41582371	missense	possibly damaging	0.73
R6476:Gm340	UTSW	19	41583079	missense	probably benign	0.04
R7051:Gm340	UTSW	19	41585752	missense	probably benign	0.05
R7285:Gm340	UTSW	19	41584315	missense	possibly damaging	0.91
R7372:Gm340	UTSW	19	41585506	missense	probably damaging	1.00
R7762:Gm340	UTSW	19	41583667	missense	probably benign	0.02
R7926:Gm340	UTSW	19	41582569	missense	probably benign
R8164:Gm340	UTSW	19	41585410	missense	probably damaging	1.00
R8319:Gm340	UTSW	19	41582904	missense	probably damaging	1.00
R8323:Gm340	UTSW	19	41583597	missense	probably benign	0.01
R8327:Gm340	UTSW	19	41582557	missense	probably damaging	1.00
R8423:Gm340	UTSW	19	41585449	missense	possibly damaging	0.95
R8780:Gm340	UTSW	19	41585259	missense	probably damaging	1.00
R8781:Gm340	UTSW	19	41585259	missense	probably damaging	1.00
R8788:Gm340	UTSW	19	41585259	missense	probably damaging	1.00
R8798:Gm340	UTSW	19	41585259	missense	probably damaging	1.00
R9013:Gm340	UTSW	19	41584750	missense	probably damaging	1.00
R9035:Gm340	UTSW	19	41584960	missense	probably benign	0.00
R9065:Gm340	UTSW	19	41585259	missense	probably damaging	1.00
R9067:Gm340	UTSW	19	41585259	missense	probably damaging	1.00
R9083:Gm340	UTSW	19	41586400	missense	probably damaging	0.99
R9105:Gm340	UTSW	19	41584872	missense	possibly damaging	0.88
R9487:Gm340	UTSW	19	41585246	missense	probably damaging	1.00
R9573:Gm340	UTSW	19	41585032	missense	probably damaging	1.00
R9704:Gm340	UTSW	19	41584059	missense	possibly damaging	0.61
X0013:Gm340	UTSW	19	41584532	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGCCAGGGTTTGGATTCATC -3'
(R):5'- AGGAATGCTTTCTGAGGGC -3'

Sequencing Primer
(F):5'- CCGCTGCTTGCTCTGAAATCAAG -3'
(R):5'- TCATCTATCTTGGACCAGACATG -3'

Posted On

2019-12-20