Incidental Mutation 'R7834:Slc2a8'
ID605829
Institutional Source Beutler Lab
Gene Symbol Slc2a8
Ensembl Gene ENSMUSG00000026791
Gene Namesolute carrier family 2, (facilitated glucose transporter), member 8
SynonymsD2Ertd44e, GlutX1, GLUT8
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.458) question?
Stock #R7834 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location32972990-32982083 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32976907 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 227 (G227D)
Ref Sequence ENSEMBL: ENSMUSP00000028129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028129] [ENSMUST00000153484] [ENSMUST00000193695] [ENSMUST00000194066] [ENSMUST00000195863]
Predicted Effect probably damaging
Transcript: ENSMUST00000028129
AA Change: G227D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028129
Gene: ENSMUSG00000026791
AA Change: G227D

DomainStartEndE-ValueType
Pfam:MFS_1 26 425 2e-22 PFAM
Pfam:Sugar_tr 29 474 2.7e-98 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153484
AA Change: G227D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141959
Gene: ENSMUSG00000026791
AA Change: G227D

DomainStartEndE-ValueType
Pfam:MFS_1 26 296 1.4e-18 PFAM
Pfam:Sugar_tr 29 295 1.5e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000193695
AA Change: G227D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142100
Gene: ENSMUSG00000026791
AA Change: G227D

DomainStartEndE-ValueType
Pfam:MFS_1 26 290 1.2e-18 PFAM
Pfam:Sugar_tr 29 290 1.4e-58 PFAM
Predicted Effect silent
Transcript: ENSMUST00000194066
SMART Domains Protein: ENSMUSP00000141969
Gene: ENSMUSG00000026791

DomainStartEndE-ValueType
low complexity region 34 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195863
SMART Domains Protein: ENSMUSP00000141879
Gene: ENSMUSG00000026791

DomainStartEndE-ValueType
Pfam:Sugar_tr 1 60 8.7e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the solute carrier 2A family, which includes intracellular glucose transporters. Based on sequence comparison, the glucose transporters are grouped into three classes and this gene is a member of class II. The encoded protein, like other members of the family, contains several conserved residues and motifs and 12 transmembrane domains with both amino and carboxyl ends being on the cytosolic side of the membrane. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for one null allele show reduced spermatozoan ATP levels, mitochondrial membrane potential and sperm motility, and a slight deviation from the expected Mendelian frequency. Homozygotes for another null allele show increased hippocampus cell proliferation and cardiac P-wave duration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,284,724 I626N probably damaging Het
Abcc12 T A 8: 86,531,550 Y779F possibly damaging Het
Abcc12 C T 8: 86,558,230 C252Y probably damaging Het
Adam22 A T 5: 8,130,535 C521S probably damaging Het
Adcy5 C A 16: 35,157,200 H368N probably benign Het
Akap13 T A 7: 75,742,642 I2411N possibly damaging Het
Ankrd12 A G 17: 65,987,352 F339S probably damaging Het
Bmp1 T A 14: 70,508,565 R153W probably damaging Het
Bmp6 T C 13: 38,469,667 F237L probably damaging Het
Cacna1c A G 6: 118,610,581 S1628P Het
Ccdc141 T C 2: 77,059,545 R468G possibly damaging Het
Cdc40 A T 10: 40,882,949 S43T probably benign Het
Celf4 A G 18: 25,753,485 M48T probably benign Het
Clec4g A T 8: 3,716,500 M267K probably damaging Het
Col6a1 G T 10: 76,709,928 S903R unknown Het
Creg2 A G 1: 39,650,634 F103L probably damaging Het
Dchs1 G A 7: 105,765,567 A756V probably benign Het
Diaph1 G A 18: 37,853,709 probably benign Het
Dmxl1 G A 18: 49,920,977 G2550D probably damaging Het
Dst G T 1: 34,194,105 R3396I probably benign Het
Dync2h1 T C 9: 7,118,953 T2171A probably benign Het
Fgd2 C T 17: 29,364,951 T113M probably damaging Het
Galnt6 G T 15: 100,714,103 S219R probably damaging Het
Gbp6 T A 5: 105,273,265 E558V probably benign Het
Gnas A T 2: 174,298,990 K377* probably null Het
Hars2 T C 18: 36,789,581 I389T probably damaging Het
Hsp90ab1 T C 17: 45,571,165 I123V possibly damaging Het
Igkv6-14 A T 6: 70,435,008 N97K possibly damaging Het
Isg20 T C 7: 78,920,119 L168P probably damaging Het
Kcna1 C T 6: 126,642,740 D206N probably benign Het
Kcnn3 A G 3: 89,521,354 I296V probably damaging Het
Kif18a G A 2: 109,296,774 R351H probably damaging Het
Klra5 A T 6: 129,899,290 probably null Het
Krt9 T C 11: 100,192,666 T180A probably benign Het
Lhx8 T C 3: 154,311,537 S323G probably null Het
Lpcat2 T A 8: 92,918,101 L506H possibly damaging Het
Map2 A G 1: 66,416,488 E1447G probably damaging Het
Mapk8ip2 A T 15: 89,461,373 I779F probably damaging Het
Mcmdc2 G A 1: 9,912,174 probably null Het
Mrps15 G A 4: 126,055,389 E217K probably damaging Het
Muc5b G A 7: 141,859,070 G1918R unknown Het
Mug2 T C 6: 122,036,282 I336T probably benign Het
Myh10 T C 11: 68,785,826 V878A probably damaging Het
Nomo1 T C 7: 46,056,738 probably null Het
Ogdhl T A 14: 32,340,709 I584N probably benign Het
Pdzrn3 G A 6: 101,151,195 R837C probably damaging Het
Pkhd1 A G 1: 20,312,049 M2626T probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Pnliprp2 T C 19: 58,774,159 S399P probably benign Het
Ppp1r18 CGAGGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGAGGA 17: 35,873,851 probably benign Het
Prelp T C 1: 133,914,772 T212A probably damaging Het
Ptpn13 T A 5: 103,462,148 S4T probably damaging Het
Ptprb A C 10: 116,339,424 E821A probably benign Het
Rabgap1 T C 2: 37,469,407 probably benign Het
Reln C T 5: 22,039,635 V782M possibly damaging Het
Rpl3l T C 17: 24,733,463 V52A possibly damaging Het
Rrp1b T C 17: 32,051,724 V219A probably benign Het
Rtn1 T A 12: 72,304,032 I468F probably damaging Het
Safb T A 17: 56,593,881 M129K unknown Het
Sall1 C A 8: 89,033,374 S34I probably benign Het
Slco4a1 G T 2: 180,465,677 V295L probably benign Het
Slfn5 A T 11: 82,960,452 Q525L possibly damaging Het
Speg C T 1: 75,384,927 T195M probably damaging Het
Syne2 A T 12: 75,967,247 T3071S probably benign Het
Syngr1 G T 15: 80,111,617 W119L probably damaging Het
Tenm2 A G 11: 36,024,854 L1951P probably damaging Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Ush2a G A 1: 188,733,440 W2735* probably null Het
Usp17lb T A 7: 104,841,511 T70S probably damaging Het
Vmn2r6 T G 3: 64,538,022 N761H probably damaging Het
Vps13d A T 4: 145,108,573 I2741K Het
Wdr38 A T 2: 39,000,184 Q110L possibly damaging Het
Zfp872 A G 9: 22,200,110 K295R probably damaging Het
Other mutations in Slc2a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Slc2a8 APN 2 32973624 missense probably damaging 0.99
IGL01341:Slc2a8 APN 2 32975991 missense probably damaging 1.00
R0063:Slc2a8 UTSW 2 32979999 splice site probably null
R0063:Slc2a8 UTSW 2 32979999 splice site probably null
R0243:Slc2a8 UTSW 2 32980104 intron probably benign
R0530:Slc2a8 UTSW 2 32973684 missense probably benign 0.32
R0972:Slc2a8 UTSW 2 32975367 missense probably benign
R1919:Slc2a8 UTSW 2 32980079 missense probably damaging 1.00
R2015:Slc2a8 UTSW 2 32981380 missense probably benign 0.01
R2893:Slc2a8 UTSW 2 32974954 missense probably damaging 1.00
R5144:Slc2a8 UTSW 2 32981773 missense probably damaging 0.96
R5685:Slc2a8 UTSW 2 32981789 missense possibly damaging 0.87
R5744:Slc2a8 UTSW 2 32976028 missense probably benign 0.00
R6717:Slc2a8 UTSW 2 32976177 missense probably damaging 1.00
R7828:Slc2a8 UTSW 2 32980068 nonsense probably null
R7917:Slc2a8 UTSW 2 32976907 missense probably damaging 1.00
X0061:Slc2a8 UTSW 2 32975448 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACTAAAGTGGGGCTCCAGC -3'
(R):5'- TATCATTGGAGTGAGTCCCGG -3'

Sequencing Primer
(F):5'- CCAACCCCCACCTGCTCAG -3'
(R):5'- GGCTCACCCTGGCTTTGAC -3'
Posted On2019-12-20