Incidental Mutation 'R7834:Wdr38'
ID 605831
Institutional Source Beutler Lab
Gene Symbol Wdr38
Ensembl Gene ENSMUSG00000035295
Gene Name WD repeat domain 38
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R7834 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 38997476-39006168 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 39000184 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 110 (Q110L)
Ref Sequence ENSEMBL: ENSMUSP00000108493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039535] [ENSMUST00000080861] [ENSMUST00000112872]
AlphaFold Q9D994
Predicted Effect possibly damaging
Transcript: ENSMUST00000039535
AA Change: Q110L

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000043834
Gene: ENSMUSG00000035295
AA Change: Q110L

DomainStartEndE-ValueType
WD40 15 54 9.67e-7 SMART
WD40 57 96 9.22e-13 SMART
WD40 99 138 4.4e-10 SMART
WD40 141 180 1.21e-7 SMART
WD40 186 224 9.97e-9 SMART
WD40 227 266 4.34e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080861
SMART Domains Protein: ENSMUSP00000079672
Gene: ENSMUSG00000062997

DomainStartEndE-ValueType
Pfam:Ribosomal_L29 7 63 2.7e-22 PFAM
low complexity region 95 108 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112872
AA Change: Q110L

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108493
Gene: ENSMUSG00000035295
AA Change: Q110L

DomainStartEndE-ValueType
WD40 15 54 9.67e-7 SMART
WD40 57 96 9.22e-13 SMART
WD40 99 138 4.4e-10 SMART
WD40 141 180 1.21e-7 SMART
WD40 186 224 9.97e-9 SMART
WD40 227 266 4.34e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,284,724 I626N probably damaging Het
Abcc12 T A 8: 86,531,550 Y779F possibly damaging Het
Abcc12 C T 8: 86,558,230 C252Y probably damaging Het
Adam22 A T 5: 8,130,535 C521S probably damaging Het
Adcy5 C A 16: 35,157,200 H368N probably benign Het
Akap13 T A 7: 75,742,642 I2411N possibly damaging Het
Ankrd12 A G 17: 65,987,352 F339S probably damaging Het
Bmp1 T A 14: 70,508,565 R153W probably damaging Het
Bmp6 T C 13: 38,469,667 F237L probably damaging Het
Cacna1c A G 6: 118,610,581 S1628P Het
Ccdc141 T C 2: 77,059,545 R468G possibly damaging Het
Cdc40 A T 10: 40,882,949 S43T probably benign Het
Celf4 A G 18: 25,753,485 M48T probably benign Het
Clec4g A T 8: 3,716,500 M267K probably damaging Het
Col6a1 G T 10: 76,709,928 S903R unknown Het
Creg2 A G 1: 39,650,634 F103L probably damaging Het
Cul9 T C 17: 46,525,704 probably null Het
Dchs1 G A 7: 105,765,567 A756V probably benign Het
Diaph1 G A 18: 37,853,709 probably benign Het
Dmxl1 G A 18: 49,920,977 G2550D probably damaging Het
Dst G T 1: 34,194,105 R3396I probably benign Het
Dync2h1 T C 9: 7,118,953 T2171A probably benign Het
Fgd2 C T 17: 29,364,951 T113M probably damaging Het
Galnt6 G T 15: 100,714,103 S219R probably damaging Het
Gbp6 T A 5: 105,273,265 E558V probably benign Het
Gnas A T 2: 174,298,990 K377* probably null Het
Hars2 T C 18: 36,789,581 I389T probably damaging Het
Hsp90ab1 T C 17: 45,571,165 I123V possibly damaging Het
Igkv6-14 A T 6: 70,435,008 N97K possibly damaging Het
Isg20 T C 7: 78,920,119 L168P probably damaging Het
Kcna1 C T 6: 126,642,740 D206N probably benign Het
Kcnn3 A G 3: 89,521,354 I296V probably damaging Het
Kif18a G A 2: 109,296,774 R351H probably damaging Het
Klra5 A T 6: 129,899,290 probably null Het
Krt9 T C 11: 100,192,666 T180A probably benign Het
Lhx8 T C 3: 154,311,537 S323G probably null Het
Lpcat2 T A 8: 92,918,101 L506H possibly damaging Het
Map2 A G 1: 66,416,488 E1447G probably damaging Het
Mapk8ip2 A T 15: 89,461,373 I779F probably damaging Het
Mcmdc2 G A 1: 9,912,174 probably null Het
Mrps15 G A 4: 126,055,389 E217K probably damaging Het
Muc5b G A 7: 141,859,070 G1918R unknown Het
Mug2 T C 6: 122,036,282 I336T probably benign Het
Myh10 T C 11: 68,785,826 V878A probably damaging Het
Nomo1 T C 7: 46,056,738 probably null Het
Ogdhl T A 14: 32,340,709 I584N probably benign Het
Pdzrn3 G A 6: 101,151,195 R837C probably damaging Het
Pkhd1 A G 1: 20,312,049 M2626T probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Pnliprp2 T C 19: 58,774,159 S399P probably benign Het
Prelp T C 1: 133,914,772 T212A probably damaging Het
Ptpn13 T A 5: 103,462,148 S4T probably damaging Het
Ptprb A C 10: 116,339,424 E821A probably benign Het
Rabgap1 T C 2: 37,469,407 probably benign Het
Reln C T 5: 22,039,635 V782M possibly damaging Het
Rpl3l T C 17: 24,733,463 V52A possibly damaging Het
Rrp1b T C 17: 32,051,724 V219A probably benign Het
Rtn1 T A 12: 72,304,032 I468F probably damaging Het
Safb T A 17: 56,593,881 M129K unknown Het
Sall1 C A 8: 89,033,374 S34I probably benign Het
Slc2a8 C T 2: 32,976,907 G227D probably damaging Het
Slco4a1 G T 2: 180,465,677 V295L probably benign Het
Slfn5 A T 11: 82,960,452 Q525L possibly damaging Het
Speg C T 1: 75,384,927 T195M probably damaging Het
Syne2 A T 12: 75,967,247 T3071S probably benign Het
Syngr1 G T 15: 80,111,617 W119L probably damaging Het
Tenm2 A G 11: 36,024,854 L1951P probably damaging Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Ush2a G A 1: 188,733,440 W2735* probably null Het
Usp17lb T A 7: 104,841,511 T70S probably damaging Het
Vmn2r6 T G 3: 64,538,022 N761H probably damaging Het
Vps13d A T 4: 145,108,573 I2741K Het
Zfp872 A G 9: 22,200,110 K295R probably damaging Het
Other mutations in Wdr38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Wdr38 APN 2 39000718 missense probably damaging 1.00
IGL02019:Wdr38 APN 2 38998412 missense probably damaging 0.97
IGL02020:Wdr38 APN 2 38998412 missense probably damaging 0.97
IGL02137:Wdr38 APN 2 38998412 missense probably damaging 0.97
IGL02138:Wdr38 APN 2 38998412 missense probably damaging 0.97
IGL02172:Wdr38 APN 2 38998412 missense probably damaging 0.97
IGL02178:Wdr38 APN 2 38998412 missense probably damaging 0.97
IGL02422:Wdr38 APN 2 38998412 missense probably damaging 0.97
IGL02423:Wdr38 APN 2 38998412 missense probably damaging 0.97
IGL02525:Wdr38 APN 2 38998412 missense probably damaging 0.97
IGL02526:Wdr38 APN 2 38998412 missense probably damaging 0.97
IGL02621:Wdr38 APN 2 38998412 missense probably damaging 0.97
IGL02623:Wdr38 APN 2 38998412 missense probably damaging 0.97
IGL02624:Wdr38 APN 2 38998412 missense probably damaging 0.97
IGL02625:Wdr38 APN 2 38998412 missense probably damaging 0.97
PIT4696001:Wdr38 UTSW 2 38999972 critical splice acceptor site probably null
R1473:Wdr38 UTSW 2 39000979 missense probably benign 0.03
R1794:Wdr38 UTSW 2 39000729 missense probably damaging 1.00
R3964:Wdr38 UTSW 2 38999350 missense probably damaging 1.00
R6005:Wdr38 UTSW 2 39001321 missense possibly damaging 0.57
R6432:Wdr38 UTSW 2 39000711 missense probably damaging 1.00
R6513:Wdr38 UTSW 2 38999958 splice site probably null
R7266:Wdr38 UTSW 2 39000264 missense probably damaging 1.00
R7454:Wdr38 UTSW 2 38998340 start gained probably benign
R8333:Wdr38 UTSW 2 38999349 missense probably damaging 1.00
R9542:Wdr38 UTSW 2 39000198 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGGCCCAGTGAAGTCTTG -3'
(R):5'- CTGGAACCTGCATCTGATTGG -3'

Sequencing Primer
(F):5'- GCCCAGTGAAGTCTTGCTGTTTC -3'
(R):5'- AACCTGCATCTGATTGGGTGTG -3'
Posted On 2019-12-20