Incidental Mutation 'R7834:Abcb11'
ID 605832
Institutional Source Beutler Lab
Gene Symbol Abcb11
Ensembl Gene ENSMUSG00000027048
Gene Name ATP-binding cassette, sub-family B member 11
Synonyms sister of P-glycoprotein, ABC16, PFIC2, Bsep, PGY4, Lith1
MMRRC Submission 045888-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.732) question?
Stock # R7834 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 69068626-69172960 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 69115068 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 626 (I626N)
Ref Sequence ENSEMBL: ENSMUSP00000099771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]
AlphaFold Q9QY30
Predicted Effect probably damaging
Transcript: ENSMUST00000102709
AA Change: I626N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: I626N

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102710
AA Change: I626N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: I626N

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180142
AA Change: I626N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: I626N

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T A 8: 87,258,179 (GRCm39) Y779F possibly damaging Het
Abcc12 C T 8: 87,284,859 (GRCm39) C252Y probably damaging Het
Adam22 A T 5: 8,180,535 (GRCm39) C521S probably damaging Het
Adcy5 C A 16: 34,977,570 (GRCm39) H368N probably benign Het
Akap13 T A 7: 75,392,390 (GRCm39) I2411N possibly damaging Het
Ankrd12 A G 17: 66,294,347 (GRCm39) F339S probably damaging Het
Bmp1 T A 14: 70,746,005 (GRCm39) R153W probably damaging Het
Bmp6 T C 13: 38,653,643 (GRCm39) F237L probably damaging Het
Cacna1c A G 6: 118,587,542 (GRCm39) S1628P Het
Ccdc141 T C 2: 76,889,889 (GRCm39) R468G possibly damaging Het
Cdc40 A T 10: 40,758,945 (GRCm39) S43T probably benign Het
Celf4 A G 18: 25,886,542 (GRCm39) M48T probably benign Het
Clec4g A T 8: 3,766,500 (GRCm39) M267K probably damaging Het
Col6a1 G T 10: 76,545,762 (GRCm39) S903R unknown Het
Creg2 A G 1: 39,689,802 (GRCm39) F103L probably damaging Het
Cul9 T C 17: 46,836,630 (GRCm39) probably null Het
Dchs1 G A 7: 105,414,774 (GRCm39) A756V probably benign Het
Diaph1 G A 18: 37,986,762 (GRCm39) probably benign Het
Dmxl1 G A 18: 50,054,044 (GRCm39) G2550D probably damaging Het
Dst G T 1: 34,233,186 (GRCm39) R3396I probably benign Het
Dync2h1 T C 9: 7,118,953 (GRCm39) T2171A probably benign Het
Fgd2 C T 17: 29,583,925 (GRCm39) T113M probably damaging Het
Galnt6 G T 15: 100,611,984 (GRCm39) S219R probably damaging Het
Gbp6 T A 5: 105,421,131 (GRCm39) E558V probably benign Het
Gnas A T 2: 174,140,783 (GRCm39) K377* probably null Het
Hars2 T C 18: 36,922,634 (GRCm39) I389T probably damaging Het
Hsp90ab1 T C 17: 45,882,091 (GRCm39) I123V possibly damaging Het
Igkv6-14 A T 6: 70,411,992 (GRCm39) N97K possibly damaging Het
Isg20 T C 7: 78,569,867 (GRCm39) L168P probably damaging Het
Kcna1 C T 6: 126,619,703 (GRCm39) D206N probably benign Het
Kcnn3 A G 3: 89,428,661 (GRCm39) I296V probably damaging Het
Kif18a G A 2: 109,127,119 (GRCm39) R351H probably damaging Het
Klra5 A T 6: 129,876,253 (GRCm39) probably null Het
Krt9 T C 11: 100,083,492 (GRCm39) T180A probably benign Het
Lhx8 T C 3: 154,017,174 (GRCm39) S323G probably null Het
Lpcat2 T A 8: 93,644,729 (GRCm39) L506H possibly damaging Het
Map2 A G 1: 66,455,647 (GRCm39) E1447G probably damaging Het
Mapk8ip2 A T 15: 89,345,576 (GRCm39) I779F probably damaging Het
Mcmdc2 G A 1: 9,982,399 (GRCm39) probably null Het
Mrps15 G A 4: 125,949,182 (GRCm39) E217K probably damaging Het
Muc5b G A 7: 141,412,807 (GRCm39) G1918R unknown Het
Mug2 T C 6: 122,013,241 (GRCm39) I336T probably benign Het
Myh10 T C 11: 68,676,652 (GRCm39) V878A probably damaging Het
Nomo1 T C 7: 45,706,162 (GRCm39) probably null Het
Ogdhl T A 14: 32,062,666 (GRCm39) I584N probably benign Het
Pdzrn3 G A 6: 101,128,156 (GRCm39) R837C probably damaging Het
Pkhd1 A G 1: 20,382,273 (GRCm39) M2626T probably benign Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Pnliprp2 T C 19: 58,762,591 (GRCm39) S399P probably benign Het
Prelp T C 1: 133,842,510 (GRCm39) T212A probably damaging Het
Ptpn13 T A 5: 103,610,014 (GRCm39) S4T probably damaging Het
Ptprb A C 10: 116,175,329 (GRCm39) E821A probably benign Het
Rabgap1 T C 2: 37,359,419 (GRCm39) probably benign Het
Reln C T 5: 22,244,633 (GRCm39) V782M possibly damaging Het
Rpl3l T C 17: 24,952,437 (GRCm39) V52A possibly damaging Het
Rrp1b T C 17: 32,270,698 (GRCm39) V219A probably benign Het
Rtn1 T A 12: 72,350,806 (GRCm39) I468F probably damaging Het
Safb T A 17: 56,900,881 (GRCm39) M129K unknown Het
Sall1 C A 8: 89,760,002 (GRCm39) S34I probably benign Het
Slc2a8 C T 2: 32,866,919 (GRCm39) G227D probably damaging Het
Slco4a1 G T 2: 180,107,470 (GRCm39) V295L probably benign Het
Slfn5 A T 11: 82,851,278 (GRCm39) Q525L possibly damaging Het
Speg C T 1: 75,361,571 (GRCm39) T195M probably damaging Het
Syne2 A T 12: 76,014,021 (GRCm39) T3071S probably benign Het
Syngr1 G T 15: 79,995,818 (GRCm39) W119L probably damaging Het
Tenm2 A G 11: 35,915,681 (GRCm39) L1951P probably damaging Het
Ulk4 C T 9: 121,092,734 (GRCm39) E168K possibly damaging Het
Ush2a G A 1: 188,465,637 (GRCm39) W2735* probably null Het
Usp17lb T A 7: 104,490,718 (GRCm39) T70S probably damaging Het
Vmn2r6 T G 3: 64,445,443 (GRCm39) N761H probably damaging Het
Vps13d A T 4: 144,835,143 (GRCm39) I2741K Het
Wdr38 A T 2: 38,890,196 (GRCm39) Q110L possibly damaging Het
Zfp872 A G 9: 22,111,406 (GRCm39) K295R probably damaging Het
Other mutations in Abcb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Abcb11 APN 2 69,115,025 (GRCm39) missense possibly damaging 0.90
IGL01407:Abcb11 APN 2 69,076,288 (GRCm39) missense probably damaging 1.00
IGL01583:Abcb11 APN 2 69,126,753 (GRCm39) missense possibly damaging 0.81
IGL01813:Abcb11 APN 2 69,117,936 (GRCm39) splice site probably benign
IGL01885:Abcb11 APN 2 69,117,971 (GRCm39) missense probably damaging 1.00
IGL01937:Abcb11 APN 2 69,117,956 (GRCm39) missense probably damaging 1.00
IGL02058:Abcb11 APN 2 69,073,842 (GRCm39) missense probably damaging 0.98
IGL02117:Abcb11 APN 2 69,154,169 (GRCm39) splice site probably benign
IGL02119:Abcb11 APN 2 69,158,344 (GRCm39) critical splice acceptor site probably null
IGL02120:Abcb11 APN 2 69,087,654 (GRCm39) missense probably damaging 1.00
IGL02158:Abcb11 APN 2 69,130,269 (GRCm39) missense probably damaging 0.96
IGL02212:Abcb11 APN 2 69,079,233 (GRCm39) missense probably damaging 0.97
IGL02306:Abcb11 APN 2 69,095,801 (GRCm39) nonsense probably null
IGL02505:Abcb11 APN 2 69,076,105 (GRCm39) missense probably damaging 1.00
IGL02538:Abcb11 APN 2 69,136,949 (GRCm39) missense possibly damaging 0.67
IGL02793:Abcb11 APN 2 69,122,293 (GRCm39) missense possibly damaging 0.90
IGL02863:Abcb11 APN 2 69,115,026 (GRCm39) missense probably damaging 0.99
IGL02875:Abcb11 APN 2 69,122,293 (GRCm39) missense possibly damaging 0.90
IGL03164:Abcb11 APN 2 69,122,343 (GRCm39) nonsense probably null
IGL03181:Abcb11 APN 2 69,158,352 (GRCm39) intron probably benign
3-1:Abcb11 UTSW 2 69,158,337 (GRCm39) missense probably benign 0.00
FR4737:Abcb11 UTSW 2 69,073,862 (GRCm39) missense probably damaging 0.97
R0031:Abcb11 UTSW 2 69,115,652 (GRCm39) missense probably damaging 1.00
R0398:Abcb11 UTSW 2 69,117,010 (GRCm39) missense probably null 0.82
R0413:Abcb11 UTSW 2 69,158,355 (GRCm39) intron probably benign
R0437:Abcb11 UTSW 2 69,087,639 (GRCm39) missense probably damaging 1.00
R0496:Abcb11 UTSW 2 69,108,228 (GRCm39) splice site probably benign
R0646:Abcb11 UTSW 2 69,115,627 (GRCm39) missense probably damaging 1.00
R0669:Abcb11 UTSW 2 69,159,662 (GRCm39) missense probably benign 0.15
R0856:Abcb11 UTSW 2 69,154,262 (GRCm39) missense probably benign
R1061:Abcb11 UTSW 2 69,108,153 (GRCm39) missense probably benign 0.00
R1460:Abcb11 UTSW 2 69,087,718 (GRCm39) splice site probably benign
R1714:Abcb11 UTSW 2 69,136,925 (GRCm39) missense probably damaging 0.99
R1739:Abcb11 UTSW 2 69,091,910 (GRCm39) missense probably damaging 1.00
R1856:Abcb11 UTSW 2 69,076,267 (GRCm39) missense probably damaging 1.00
R1994:Abcb11 UTSW 2 69,113,014 (GRCm39) splice site probably null
R2086:Abcb11 UTSW 2 69,089,820 (GRCm39) splice site probably benign
R2133:Abcb11 UTSW 2 69,154,227 (GRCm39) missense possibly damaging 0.65
R2516:Abcb11 UTSW 2 69,159,673 (GRCm39) missense possibly damaging 0.88
R2930:Abcb11 UTSW 2 69,087,702 (GRCm39) missense probably damaging 0.96
R3771:Abcb11 UTSW 2 69,159,720 (GRCm39) splice site probably benign
R3772:Abcb11 UTSW 2 69,159,720 (GRCm39) splice site probably benign
R3979:Abcb11 UTSW 2 69,154,320 (GRCm39) missense probably benign 0.11
R4227:Abcb11 UTSW 2 69,115,120 (GRCm39) missense probably damaging 1.00
R4255:Abcb11 UTSW 2 69,136,949 (GRCm39) missense probably benign 0.03
R4614:Abcb11 UTSW 2 69,115,025 (GRCm39) missense possibly damaging 0.90
R4647:Abcb11 UTSW 2 69,115,615 (GRCm39) missense probably damaging 1.00
R4719:Abcb11 UTSW 2 69,089,971 (GRCm39) missense probably damaging 1.00
R4734:Abcb11 UTSW 2 69,154,306 (GRCm39) missense possibly damaging 0.73
R4765:Abcb11 UTSW 2 69,076,211 (GRCm39) missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69,076,249 (GRCm39) missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69,076,249 (GRCm39) missense probably damaging 1.00
R4870:Abcb11 UTSW 2 69,069,540 (GRCm39) missense probably damaging 0.99
R4988:Abcb11 UTSW 2 69,154,236 (GRCm39) missense probably benign 0.12
R5028:Abcb11 UTSW 2 69,104,356 (GRCm39) missense probably damaging 1.00
R5048:Abcb11 UTSW 2 69,138,850 (GRCm39) missense probably benign 0.06
R5177:Abcb11 UTSW 2 69,115,639 (GRCm39) missense probably damaging 1.00
R5301:Abcb11 UTSW 2 69,117,191 (GRCm39) missense probably damaging 0.98
R5789:Abcb11 UTSW 2 69,076,108 (GRCm39) missense probably damaging 1.00
R5892:Abcb11 UTSW 2 69,091,844 (GRCm39) missense probably damaging 0.99
R6003:Abcb11 UTSW 2 69,073,811 (GRCm39) missense probably benign 0.43
R6252:Abcb11 UTSW 2 69,122,305 (GRCm39) missense probably benign 0.10
R6389:Abcb11 UTSW 2 69,154,238 (GRCm39) missense probably damaging 1.00
R6512:Abcb11 UTSW 2 69,112,996 (GRCm39) missense probably benign
R6590:Abcb11 UTSW 2 69,115,062 (GRCm39) missense probably damaging 1.00
R6690:Abcb11 UTSW 2 69,115,062 (GRCm39) missense probably damaging 1.00
R6732:Abcb11 UTSW 2 69,117,190 (GRCm39) missense probably damaging 1.00
R6870:Abcb11 UTSW 2 69,115,642 (GRCm39) missense possibly damaging 0.91
R7028:Abcb11 UTSW 2 69,096,019 (GRCm39) missense probably benign
R7223:Abcb11 UTSW 2 69,104,487 (GRCm39) missense probably benign
R7323:Abcb11 UTSW 2 69,117,979 (GRCm39) missense probably damaging 1.00
R7337:Abcb11 UTSW 2 69,076,113 (GRCm39) missense probably damaging 1.00
R7339:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7340:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7341:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7343:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7366:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7393:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7394:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7405:Abcb11 UTSW 2 69,117,963 (GRCm39) missense probably damaging 1.00
R7411:Abcb11 UTSW 2 69,134,280 (GRCm39) critical splice donor site probably null
R7488:Abcb11 UTSW 2 69,108,146 (GRCm39) missense probably benign
R7544:Abcb11 UTSW 2 69,095,830 (GRCm39) missense probably benign 0.05
R7660:Abcb11 UTSW 2 69,117,938 (GRCm39) splice site probably null
R7754:Abcb11 UTSW 2 69,117,162 (GRCm39) missense probably damaging 1.00
R7771:Abcb11 UTSW 2 69,069,535 (GRCm39) missense probably damaging 0.99
R7794:Abcb11 UTSW 2 69,117,022 (GRCm39) missense possibly damaging 0.62
R7897:Abcb11 UTSW 2 69,154,217 (GRCm39) small deletion probably benign
R7897:Abcb11 UTSW 2 69,154,216 (GRCm39) frame shift probably null
R7937:Abcb11 UTSW 2 69,154,217 (GRCm39) small deletion probably benign
R8004:Abcb11 UTSW 2 69,087,554 (GRCm39) missense possibly damaging 0.68
R8089:Abcb11 UTSW 2 69,104,383 (GRCm39) missense probably benign 0.09
R8279:Abcb11 UTSW 2 69,069,549 (GRCm39) missense probably benign 0.05
R8426:Abcb11 UTSW 2 69,155,606 (GRCm39) missense probably benign
R8441:Abcb11 UTSW 2 69,087,574 (GRCm39) missense possibly damaging 0.93
R8460:Abcb11 UTSW 2 69,154,381 (GRCm39) missense possibly damaging 0.70
R8462:Abcb11 UTSW 2 69,104,499 (GRCm39) missense probably benign
R8532:Abcb11 UTSW 2 69,090,035 (GRCm39) missense possibly damaging 0.69
R8534:Abcb11 UTSW 2 69,154,190 (GRCm39) missense possibly damaging 0.89
R8711:Abcb11 UTSW 2 69,095,856 (GRCm39) missense probably damaging 1.00
R8746:Abcb11 UTSW 2 69,087,754 (GRCm39) intron probably benign
R8964:Abcb11 UTSW 2 69,117,061 (GRCm39) missense possibly damaging 0.52
R8990:Abcb11 UTSW 2 69,104,494 (GRCm39) missense
R9081:Abcb11 UTSW 2 69,122,388 (GRCm39) missense possibly damaging 0.59
R9093:Abcb11 UTSW 2 69,069,513 (GRCm39) missense probably damaging 0.97
R9228:Abcb11 UTSW 2 69,138,809 (GRCm39) nonsense probably null
R9294:Abcb11 UTSW 2 69,095,840 (GRCm39) missense possibly damaging 0.89
X0058:Abcb11 UTSW 2 69,119,787 (GRCm39) missense probably benign 0.12
X0062:Abcb11 UTSW 2 69,076,250 (GRCm39) missense probably damaging 1.00
X0065:Abcb11 UTSW 2 69,130,210 (GRCm39) missense probably damaging 0.99
Z1176:Abcb11 UTSW 2 69,122,325 (GRCm39) missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69,159,613 (GRCm39) critical splice donor site probably null
Z1177:Abcb11 UTSW 2 69,136,873 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTGAACCAGCAGCATAAATG -3'
(R):5'- TGGCTACAAGACACTGTTGGC -3'

Sequencing Primer
(F):5'- GAAAGAGGTACTTGCCCT -3'
(R):5'- GGCTACAAGACACTGTTGGCTATTTC -3'
Posted On 2019-12-20