Mutagenetix > Incidental Mutations

Incidental Mutation 'R7834:Kif18a'

605834

Institutional Source

Beutler Lab

Gene Symbol

Kif18a

Ensembl Gene

ENSMUSG00000027115

Gene Name

kinesin family member 18A

Synonyms

B130001M12Rik, N-8 kinesin

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7834 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

109280738-109341747 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 109296774 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 351 (R351H)

Ref Sequence

ENSEMBL: ENSMUSP00000028527 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028527]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028527
AA Change: R351H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028527
Gene: ENSMUSG00000027115
AA Change: R351H

Domain	Start	End	E-Value	Type
KISc	9	363	8.91e-158	SMART
Blast:KISc	382	433	1e-14	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] KIF18A is a member of the kinesin superfamily of microtubule-associated molecular motors (see MIM 148760) that use hydrolysis of ATP to produce force and movement along microtubules (Luboshits and Benayahu, 2005 [PubMed 15878648]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for loss of function alleles exhibit reduced female fertility and male infertility due to primordial germ cell depletion. The sterility phenotype is incompletely penetrant, has variable expressivity, and is modulated by strain background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	T	2: 69,284,724	I626N	probably damaging	Het
Abcc12	T	A	8: 86,531,550	Y779F	possibly damaging	Het
Abcc12	C	T	8: 86,558,230	C252Y	probably damaging	Het
Adam22	A	T	5: 8,130,535	C521S	probably damaging	Het
Adcy5	C	A	16: 35,157,200	H368N	probably benign	Het
Akap13	T	A	7: 75,742,642	I2411N	possibly damaging	Het
Ankrd12	A	G	17: 65,987,352	F339S	probably damaging	Het
Bmp1	T	A	14: 70,508,565	R153W	probably damaging	Het
Bmp6	T	C	13: 38,469,667	F237L	probably damaging	Het
Cacna1c	A	G	6: 118,610,581	S1628P		Het
Ccdc141	T	C	2: 77,059,545	R468G	possibly damaging	Het
Cdc40	A	T	10: 40,882,949	S43T	probably benign	Het
Celf4	A	G	18: 25,753,485	M48T	probably benign	Het
Clec4g	A	T	8: 3,716,500	M267K	probably damaging	Het
Col6a1	G	T	10: 76,709,928	S903R	unknown	Het
Creg2	A	G	1: 39,650,634	F103L	probably damaging	Het
Dchs1	G	A	7: 105,765,567	A756V	probably benign	Het
Diaph1	G	A	18: 37,853,709		probably benign	Het
Dmxl1	G	A	18: 49,920,977	G2550D	probably damaging	Het
Dst	G	T	1: 34,194,105	R3396I	probably benign	Het
Dync2h1	T	C	9: 7,118,953	T2171A	probably benign	Het
Fgd2	C	T	17: 29,364,951	T113M	probably damaging	Het
Galnt6	G	T	15: 100,714,103	S219R	probably damaging	Het
Gbp6	T	A	5: 105,273,265	E558V	probably benign	Het
Gnas	A	T	2: 174,298,990	K377*	probably null	Het
Hars2	T	C	18: 36,789,581	I389T	probably damaging	Het
Hsp90ab1	T	C	17: 45,571,165	I123V	possibly damaging	Het
Igkv6-14	A	T	6: 70,435,008	N97K	possibly damaging	Het
Isg20	T	C	7: 78,920,119	L168P	probably damaging	Het
Kcna1	C	T	6: 126,642,740	D206N	probably benign	Het
Kcnn3	A	G	3: 89,521,354	I296V	probably damaging	Het
Klra5	A	T	6: 129,899,290		probably null	Het
Krt9	T	C	11: 100,192,666	T180A	probably benign	Het
Lhx8	T	C	3: 154,311,537	S323G	probably null	Het
Lpcat2	T	A	8: 92,918,101	L506H	possibly damaging	Het
Map2	A	G	1: 66,416,488	E1447G	probably damaging	Het
Mapk8ip2	A	T	15: 89,461,373	I779F	probably damaging	Het
Mcmdc2	G	A	1: 9,912,174		probably null	Het
Mrps15	G	A	4: 126,055,389	E217K	probably damaging	Het
Muc5b	G	A	7: 141,859,070	G1918R	unknown	Het
Mug2	T	C	6: 122,036,282	I336T	probably benign	Het
Myh10	T	C	11: 68,785,826	V878A	probably damaging	Het
Nomo1	T	C	7: 46,056,738		probably null	Het
Ogdhl	T	A	14: 32,340,709	I584N	probably benign	Het
Pdzrn3	G	A	6: 101,151,195	R837C	probably damaging	Het
Pkhd1	A	G	1: 20,312,049	M2626T	probably benign	Het
Plat	G	T	8: 22,772,232	G91W	probably damaging	Het
Pml	C	A	9: 58,234,685	R288L	probably benign	Het
Pnliprp2	T	C	19: 58,774,159	S399P	probably benign	Het
Ppp1r18	CGAGGAGGAGGAGGAGGAGGAGGA	CGAGGAGGAGGAGGAGGAGGA	17: 35,873,851		probably benign	Het
Prelp	T	C	1: 133,914,772	T212A	probably damaging	Het
Ptpn13	T	A	5: 103,462,148	S4T	probably damaging	Het
Ptprb	A	C	10: 116,339,424	E821A	probably benign	Het
Rabgap1	T	C	2: 37,469,407		probably benign	Het
Reln	C	T	5: 22,039,635	V782M	possibly damaging	Het
Rpl3l	T	C	17: 24,733,463	V52A	possibly damaging	Het
Rrp1b	T	C	17: 32,051,724	V219A	probably benign	Het
Rtn1	T	A	12: 72,304,032	I468F	probably damaging	Het
Safb	T	A	17: 56,593,881	M129K	unknown	Het
Sall1	C	A	8: 89,033,374	S34I	probably benign	Het
Slc2a8	C	T	2: 32,976,907	G227D	probably damaging	Het
Slco4a1	G	T	2: 180,465,677	V295L	probably benign	Het
Slfn5	A	T	11: 82,960,452	Q525L	possibly damaging	Het
Speg	C	T	1: 75,384,927	T195M	probably damaging	Het
Syne2	A	T	12: 75,967,247	T3071S	probably benign	Het
Syngr1	G	T	15: 80,111,617	W119L	probably damaging	Het
Tenm2	A	G	11: 36,024,854	L1951P	probably damaging	Het
Ulk4	C	T	9: 121,263,668	E168K	possibly damaging	Het
Ush2a	G	A	1: 188,733,440	W2735*	probably null	Het
Usp17lb	T	A	7: 104,841,511	T70S	probably damaging	Het
Vmn2r6	T	G	3: 64,538,022	N761H	probably damaging	Het
Vps13d	A	T	4: 145,108,573	I2741K		Het
Wdr38	A	T	2: 39,000,184	Q110L	possibly damaging	Het
Zfp872	A	G	9: 22,200,110	K295R	probably damaging	Het

Other mutations in Kif18a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Kif18a	APN	2	109317988	missense	possibly damaging	0.93
IGL00795:Kif18a	APN	2	109293020	missense	probably damaging	1.00
IGL00904:Kif18a	APN	2	109292126	missense	probably damaging	1.00
IGL00990:Kif18a	APN	2	109334422	missense	probably benign	0.01
IGL01323:Kif18a	APN	2	109298442	missense	probably benign	0.02
IGL01382:Kif18a	APN	2	109296766	nonsense	probably null
IGL02205:Kif18a	APN	2	109307018	splice site	probably benign
IGL02207:Kif18a	APN	2	109296707	missense	probably damaging	0.99
IGL02970:Kif18a	APN	2	109287888	missense	probably damaging	1.00
IGL03087:Kif18a	APN	2	109318117	splice site	probably benign
R0030:Kif18a	UTSW	2	109333318	missense	probably benign
R0482:Kif18a	UTSW	2	109287843	start codon destroyed	probably null	1.00
R0631:Kif18a	UTSW	2	109298322	splice site	probably benign
R1597:Kif18a	UTSW	2	109292991	missense	probably damaging	1.00
R1640:Kif18a	UTSW	2	109289816	missense	probably benign	0.25
R1675:Kif18a	UTSW	2	109298403	missense	probably benign
R1723:Kif18a	UTSW	2	109302882	missense	probably damaging	1.00
R2141:Kif18a	UTSW	2	109333503	missense	probably benign	0.43
R2142:Kif18a	UTSW	2	109333503	missense	probably benign	0.43
R2243:Kif18a	UTSW	2	109298107	missense	probably damaging	1.00
R3609:Kif18a	UTSW	2	109338596	missense	probably benign	0.02
R3611:Kif18a	UTSW	2	109338596	missense	probably benign	0.02
R3882:Kif18a	UTSW	2	109306974	missense	probably benign	0.01
R4292:Kif18a	UTSW	2	109298126	missense	probably damaging	0.99
R4293:Kif18a	UTSW	2	109293053	missense	probably benign
R4294:Kif18a	UTSW	2	109293053	missense	probably benign
R4295:Kif18a	UTSW	2	109293053	missense	probably benign
R4428:Kif18a	UTSW	2	109288121	missense	probably damaging	1.00
R4791:Kif18a	UTSW	2	109287875	missense	probably benign	0.16
R4819:Kif18a	UTSW	2	109292126	missense	probably damaging	1.00
R5078:Kif18a	UTSW	2	109295142	splice site	probably benign
R5175:Kif18a	UTSW	2	109302978	splice site	probably null
R5319:Kif18a	UTSW	2	109318025	missense	probably benign	0.00
R5821:Kif18a	UTSW	2	109289845	splice site	probably benign
R5966:Kif18a	UTSW	2	109292066	missense	probably damaging	1.00
R6886:Kif18a	UTSW	2	109296663	missense	probably damaging	1.00
R7069:Kif18a	UTSW	2	109295002	missense	probably damaging	0.99
R7765:Kif18a	UTSW	2	109306940	missense	probably benign	0.00
R7801:Kif18a	UTSW	2	109287845	missense	probably damaging	0.99
R7917:Kif18a	UTSW	2	109296774	missense	probably damaging	1.00
Z1176:Kif18a	UTSW	2	109318053	missense	possibly damaging	0.63
Z1177:Kif18a	UTSW	2	109294957	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCATTGCGTACATTCTCCTAC -3'
(R):5'- AGTTACCTTCAGCAGCTAGGG -3'

Sequencing Primer
(F):5'- GCGTACATTCTCCTACTGAAATAG -3'
(R):5'- GAGGACATTTCTAACCTGAACTGGC -3'

Posted On

2019-12-20