Incidental Mutation 'R7834:Mrps15'
ID 605840
Institutional Source Beutler Lab
Gene Symbol Mrps15
Ensembl Gene ENSMUSG00000028861
Gene Name mitochondrial ribosomal protein S15
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock # R7834 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 126046925-126055532 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 126055389 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 217 (E217K)
Ref Sequence ENSEMBL: ENSMUSP00000030675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030675] [ENSMUST00000035497] [ENSMUST00000143712]
AlphaFold Q9DC71
Predicted Effect probably damaging
Transcript: ENSMUST00000030675
AA Change: E217K

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030675
Gene: ENSMUSG00000028861
AA Change: E217K

DomainStartEndE-ValueType
low complexity region 24 40 N/A INTRINSIC
Ribosomal_S15 108 189 4.27e-16 SMART
coiled coil region 211 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035497
SMART Domains Protein: ENSMUSP00000045241
Gene: ENSMUSG00000042616

DomainStartEndE-ValueType
Pfam:Oscp1 17 189 1.1e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143712
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S15P family. The encoded protein is more than two times the size of its E. coli counterpart, with the 12S rRNA binding sites conserved. Between human and mouse, the encoded protein is the least conserved among small subunit ribosomal proteins. Pseudogenes corresponding to this gene are found on chromosomes 15q and 19q. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,284,724 I626N probably damaging Het
Abcc12 T A 8: 86,531,550 Y779F possibly damaging Het
Abcc12 C T 8: 86,558,230 C252Y probably damaging Het
Adam22 A T 5: 8,130,535 C521S probably damaging Het
Adcy5 C A 16: 35,157,200 H368N probably benign Het
Akap13 T A 7: 75,742,642 I2411N possibly damaging Het
Ankrd12 A G 17: 65,987,352 F339S probably damaging Het
Bmp1 T A 14: 70,508,565 R153W probably damaging Het
Bmp6 T C 13: 38,469,667 F237L probably damaging Het
Cacna1c A G 6: 118,610,581 S1628P Het
Ccdc141 T C 2: 77,059,545 R468G possibly damaging Het
Cdc40 A T 10: 40,882,949 S43T probably benign Het
Celf4 A G 18: 25,753,485 M48T probably benign Het
Clec4g A T 8: 3,716,500 M267K probably damaging Het
Col6a1 G T 10: 76,709,928 S903R unknown Het
Creg2 A G 1: 39,650,634 F103L probably damaging Het
Cul9 T C 17: 46,525,704 probably null Het
Dchs1 G A 7: 105,765,567 A756V probably benign Het
Diaph1 G A 18: 37,853,709 probably benign Het
Dmxl1 G A 18: 49,920,977 G2550D probably damaging Het
Dst G T 1: 34,194,105 R3396I probably benign Het
Dync2h1 T C 9: 7,118,953 T2171A probably benign Het
Fgd2 C T 17: 29,364,951 T113M probably damaging Het
Galnt6 G T 15: 100,714,103 S219R probably damaging Het
Gbp6 T A 5: 105,273,265 E558V probably benign Het
Gnas A T 2: 174,298,990 K377* probably null Het
Hars2 T C 18: 36,789,581 I389T probably damaging Het
Hsp90ab1 T C 17: 45,571,165 I123V possibly damaging Het
Igkv6-14 A T 6: 70,435,008 N97K possibly damaging Het
Isg20 T C 7: 78,920,119 L168P probably damaging Het
Kcna1 C T 6: 126,642,740 D206N probably benign Het
Kcnn3 A G 3: 89,521,354 I296V probably damaging Het
Kif18a G A 2: 109,296,774 R351H probably damaging Het
Klra5 A T 6: 129,899,290 probably null Het
Krt9 T C 11: 100,192,666 T180A probably benign Het
Lhx8 T C 3: 154,311,537 S323G probably null Het
Lpcat2 T A 8: 92,918,101 L506H possibly damaging Het
Map2 A G 1: 66,416,488 E1447G probably damaging Het
Mapk8ip2 A T 15: 89,461,373 I779F probably damaging Het
Mcmdc2 G A 1: 9,912,174 probably null Het
Muc5b G A 7: 141,859,070 G1918R unknown Het
Mug2 T C 6: 122,036,282 I336T probably benign Het
Myh10 T C 11: 68,785,826 V878A probably damaging Het
Nomo1 T C 7: 46,056,738 probably null Het
Ogdhl T A 14: 32,340,709 I584N probably benign Het
Pdzrn3 G A 6: 101,151,195 R837C probably damaging Het
Pkhd1 A G 1: 20,312,049 M2626T probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Pnliprp2 T C 19: 58,774,159 S399P probably benign Het
Prelp T C 1: 133,914,772 T212A probably damaging Het
Ptpn13 T A 5: 103,462,148 S4T probably damaging Het
Ptprb A C 10: 116,339,424 E821A probably benign Het
Rabgap1 T C 2: 37,469,407 probably benign Het
Reln C T 5: 22,039,635 V782M possibly damaging Het
Rpl3l T C 17: 24,733,463 V52A possibly damaging Het
Rrp1b T C 17: 32,051,724 V219A probably benign Het
Rtn1 T A 12: 72,304,032 I468F probably damaging Het
Safb T A 17: 56,593,881 M129K unknown Het
Sall1 C A 8: 89,033,374 S34I probably benign Het
Slc2a8 C T 2: 32,976,907 G227D probably damaging Het
Slco4a1 G T 2: 180,465,677 V295L probably benign Het
Slfn5 A T 11: 82,960,452 Q525L possibly damaging Het
Speg C T 1: 75,384,927 T195M probably damaging Het
Syne2 A T 12: 75,967,247 T3071S probably benign Het
Syngr1 G T 15: 80,111,617 W119L probably damaging Het
Tenm2 A G 11: 36,024,854 L1951P probably damaging Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Ush2a G A 1: 188,733,440 W2735* probably null Het
Usp17lb T A 7: 104,841,511 T70S probably damaging Het
Vmn2r6 T G 3: 64,538,022 N761H probably damaging Het
Vps13d A T 4: 145,108,573 I2741K Het
Wdr38 A T 2: 39,000,184 Q110L possibly damaging Het
Zfp872 A G 9: 22,200,110 K295R probably damaging Het
Other mutations in Mrps15
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0441:Mrps15 UTSW 4 126051417 splice site probably benign
R0850:Mrps15 UTSW 4 126048686 missense probably damaging 1.00
R1721:Mrps15 UTSW 4 126051394 missense probably benign 0.00
R1830:Mrps15 UTSW 4 126055407 missense probably damaging 0.99
R4618:Mrps15 UTSW 4 126047044 unclassified probably benign
R5590:Mrps15 UTSW 4 126048695 missense probably benign 0.33
R7775:Mrps15 UTSW 4 126051377 missense probably damaging 1.00
R7824:Mrps15 UTSW 4 126051377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCCCTGAACTGAGGTACAAAG -3'
(R):5'- TCTATGACTGCGTCCTCTGG -3'

Sequencing Primer
(F):5'- TCCCTGAACTGAGGTACAAAGAGTAG -3'
(R):5'- CCTCTTGCTCAGGTTAAAAAGAAGGC -3'
Posted On 2019-12-20