Incidental Mutation 'R7834:Mug2'
ID 605849
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Name murinoglobulin 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R7834 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 122006761-122085965 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 122036282 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 336 (I336T)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
AlphaFold P28666
Predicted Effect probably benign
Transcript: ENSMUST00000081777
AA Change: I336T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: I336T

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,284,724 I626N probably damaging Het
Abcc12 T A 8: 86,531,550 Y779F possibly damaging Het
Abcc12 C T 8: 86,558,230 C252Y probably damaging Het
Adam22 A T 5: 8,130,535 C521S probably damaging Het
Adcy5 C A 16: 35,157,200 H368N probably benign Het
Akap13 T A 7: 75,742,642 I2411N possibly damaging Het
Ankrd12 A G 17: 65,987,352 F339S probably damaging Het
Bmp1 T A 14: 70,508,565 R153W probably damaging Het
Bmp6 T C 13: 38,469,667 F237L probably damaging Het
Cacna1c A G 6: 118,610,581 S1628P Het
Ccdc141 T C 2: 77,059,545 R468G possibly damaging Het
Cdc40 A T 10: 40,882,949 S43T probably benign Het
Celf4 A G 18: 25,753,485 M48T probably benign Het
Clec4g A T 8: 3,716,500 M267K probably damaging Het
Col6a1 G T 10: 76,709,928 S903R unknown Het
Creg2 A G 1: 39,650,634 F103L probably damaging Het
Cul9 T C 17: 46,525,704 probably null Het
Dchs1 G A 7: 105,765,567 A756V probably benign Het
Diaph1 G A 18: 37,853,709 probably benign Het
Dmxl1 G A 18: 49,920,977 G2550D probably damaging Het
Dst G T 1: 34,194,105 R3396I probably benign Het
Dync2h1 T C 9: 7,118,953 T2171A probably benign Het
Fgd2 C T 17: 29,364,951 T113M probably damaging Het
Galnt6 G T 15: 100,714,103 S219R probably damaging Het
Gbp6 T A 5: 105,273,265 E558V probably benign Het
Gnas A T 2: 174,298,990 K377* probably null Het
Hars2 T C 18: 36,789,581 I389T probably damaging Het
Hsp90ab1 T C 17: 45,571,165 I123V possibly damaging Het
Igkv6-14 A T 6: 70,435,008 N97K possibly damaging Het
Isg20 T C 7: 78,920,119 L168P probably damaging Het
Kcna1 C T 6: 126,642,740 D206N probably benign Het
Kcnn3 A G 3: 89,521,354 I296V probably damaging Het
Kif18a G A 2: 109,296,774 R351H probably damaging Het
Klra5 A T 6: 129,899,290 probably null Het
Krt9 T C 11: 100,192,666 T180A probably benign Het
Lhx8 T C 3: 154,311,537 S323G probably null Het
Lpcat2 T A 8: 92,918,101 L506H possibly damaging Het
Map2 A G 1: 66,416,488 E1447G probably damaging Het
Mapk8ip2 A T 15: 89,461,373 I779F probably damaging Het
Mcmdc2 G A 1: 9,912,174 probably null Het
Mrps15 G A 4: 126,055,389 E217K probably damaging Het
Muc5b G A 7: 141,859,070 G1918R unknown Het
Myh10 T C 11: 68,785,826 V878A probably damaging Het
Nomo1 T C 7: 46,056,738 probably null Het
Ogdhl T A 14: 32,340,709 I584N probably benign Het
Pdzrn3 G A 6: 101,151,195 R837C probably damaging Het
Pkhd1 A G 1: 20,312,049 M2626T probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Pnliprp2 T C 19: 58,774,159 S399P probably benign Het
Prelp T C 1: 133,914,772 T212A probably damaging Het
Ptpn13 T A 5: 103,462,148 S4T probably damaging Het
Ptprb A C 10: 116,339,424 E821A probably benign Het
Rabgap1 T C 2: 37,469,407 probably benign Het
Reln C T 5: 22,039,635 V782M possibly damaging Het
Rpl3l T C 17: 24,733,463 V52A possibly damaging Het
Rrp1b T C 17: 32,051,724 V219A probably benign Het
Rtn1 T A 12: 72,304,032 I468F probably damaging Het
Safb T A 17: 56,593,881 M129K unknown Het
Sall1 C A 8: 89,033,374 S34I probably benign Het
Slc2a8 C T 2: 32,976,907 G227D probably damaging Het
Slco4a1 G T 2: 180,465,677 V295L probably benign Het
Slfn5 A T 11: 82,960,452 Q525L possibly damaging Het
Speg C T 1: 75,384,927 T195M probably damaging Het
Syne2 A T 12: 75,967,247 T3071S probably benign Het
Syngr1 G T 15: 80,111,617 W119L probably damaging Het
Tenm2 A G 11: 36,024,854 L1951P probably damaging Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Ush2a G A 1: 188,733,440 W2735* probably null Het
Usp17lb T A 7: 104,841,511 T70S probably damaging Het
Vmn2r6 T G 3: 64,538,022 N761H probably damaging Het
Vps13d A T 4: 145,108,573 I2741K Het
Wdr38 A T 2: 39,000,184 Q110L possibly damaging Het
Zfp872 A G 9: 22,200,110 K295R probably damaging Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122047487 missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122040654 missense probably damaging 0.99
IGL01314:Mug2 APN 6 122081279 missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122049628 splice site probably benign
IGL01477:Mug2 APN 6 122081684 splice site probably benign
IGL01926:Mug2 APN 6 122036104 splice site probably benign
IGL02019:Mug2 APN 6 122047435 missense probably benign 0.02
IGL02305:Mug2 APN 6 122036056 missense probably benign
IGL02310:Mug2 APN 6 122059123 splice site probably benign
IGL02484:Mug2 APN 6 122072753 missense probably damaging 1.00
IGL02516:Mug2 APN 6 122070843 missense probably damaging 1.00
IGL02531:Mug2 APN 6 122072771 missense probably damaging 1.00
IGL02666:Mug2 APN 6 122081326 missense probably damaging 1.00
IGL02936:Mug2 APN 6 122081387 critical splice donor site probably null
R0114:Mug2 UTSW 6 122040648 missense probably damaging 1.00
R0119:Mug2 UTSW 6 122036063 missense probably benign 0.00
R0123:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122071011 splice site probably benign
R0225:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122081599 missense probably damaging 1.00
R0763:Mug2 UTSW 6 122075294 missense probably benign
R0959:Mug2 UTSW 6 122085495 missense probably benign 0.33
R1104:Mug2 UTSW 6 122059055 missense probably benign
R1239:Mug2 UTSW 6 122081678 splice site probably benign
R1318:Mug2 UTSW 6 122077402 missense probably damaging 1.00
R1460:Mug2 UTSW 6 122040533 splice site probably benign
R1706:Mug2 UTSW 6 122036232 splice site probably benign
R1761:Mug2 UTSW 6 122074705 missense probably benign 0.20
R1901:Mug2 UTSW 6 122071842 missense probably benign 0.02
R1913:Mug2 UTSW 6 122070870 missense probably damaging 1.00
R1943:Mug2 UTSW 6 122079639 missense probably benign
R2054:Mug2 UTSW 6 122077492 missense probably damaging 1.00
R2060:Mug2 UTSW 6 122079612 missense probably benign
R2420:Mug2 UTSW 6 122083460 missense probably damaging 1.00
R2432:Mug2 UTSW 6 122084376 missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122074724 splice site probably null
R2918:Mug2 UTSW 6 122074724 splice site probably null
R3423:Mug2 UTSW 6 122047506 splice site probably benign
R3834:Mug2 UTSW 6 122049787 critical splice donor site probably null
R3902:Mug2 UTSW 6 122075567 missense probably damaging 1.00
R3941:Mug2 UTSW 6 122063563 missense probably benign
R4227:Mug2 UTSW 6 122040732 missense probably benign 0.10
R4284:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4287:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4377:Mug2 UTSW 6 122071007 critical splice donor site probably null
R4419:Mug2 UTSW 6 122079630 missense probably damaging 1.00
R4498:Mug2 UTSW 6 122082752 missense probably damaging 0.99
R4566:Mug2 UTSW 6 122079638 missense probably benign 0.00
R4690:Mug2 UTSW 6 122036296 missense probably benign
R4732:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4733:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4741:Mug2 UTSW 6 122079613 missense probably benign
R4888:Mug2 UTSW 6 122081195 missense probably damaging 1.00
R5199:Mug2 UTSW 6 122040660 missense probably benign
R5347:Mug2 UTSW 6 122081592 missense probably damaging 1.00
R5457:Mug2 UTSW 6 122049729 nonsense probably null
R5495:Mug2 UTSW 6 122079650 missense probably damaging 0.96
R5509:Mug2 UTSW 6 122084381 missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122083500 missense probably null 0.98
R6180:Mug2 UTSW 6 122079606 missense probably benign 0.01
R6184:Mug2 UTSW 6 122037046 missense probably benign
R6199:Mug2 UTSW 6 122047439 missense probably benign 0.05
R6262:Mug2 UTSW 6 122075255 missense probably damaging 1.00
R6416:Mug2 UTSW 6 122082754 missense probably damaging 1.00
R6548:Mug2 UTSW 6 122047442 missense probably damaging 1.00
R6703:Mug2 UTSW 6 122078694 missense probably benign 0.25
R7106:Mug2 UTSW 6 122082721 missense probably damaging 1.00
R7131:Mug2 UTSW 6 122075247 missense probably damaging 1.00
R7372:Mug2 UTSW 6 122083466 missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122047487 missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122040570 missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122079726 missense probably benign 0.00
R7581:Mug2 UTSW 6 122063711 missense probably damaging 1.00
R7582:Mug2 UTSW 6 122079644 missense probably damaging 0.99
R7672:Mug2 UTSW 6 122040719 missense probably benign 0.37
R7713:Mug2 UTSW 6 122078795 missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122081358 missense probably damaging 1.00
R7850:Mug2 UTSW 6 122075211 missense probably damaging 1.00
R8029:Mug2 UTSW 6 122081545 critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122075608 missense probably benign 0.01
R8335:Mug2 UTSW 6 122040584 missense probably benign
R8348:Mug2 UTSW 6 122072233 nonsense probably null
R8557:Mug2 UTSW 6 122063701 missense probably damaging 0.99
R8798:Mug2 UTSW 6 122081610 missense probably damaging 1.00
R8823:Mug2 UTSW 6 122063689 missense possibly damaging 0.89
R9029:Mug2 UTSW 6 122084369 missense probably damaging 1.00
R9153:Mug2 UTSW 6 122040668 missense possibly damaging 0.71
R9185:Mug2 UTSW 6 122077483 missense probably benign 0.06
R9186:Mug2 UTSW 6 122075289 missense probably damaging 0.99
R9418:Mug2 UTSW 6 122040741 missense probably benign 0.00
R9464:Mug2 UTSW 6 122051731 missense probably benign 0.01
R9622:Mug2 UTSW 6 122051792 missense probably benign 0.29
Z1177:Mug2 UTSW 6 122037121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATGTGAATGCAACTGTTACAG -3'
(R):5'- CTTGTGTTGCAATCAATGATGTCAG -3'

Sequencing Primer
(F):5'- TGTGAATGCAACTGTTACAGAAGAAG -3'
(R):5'- GCAATCAATGATGTCAGACATGC -3'
Posted On 2019-12-20