Incidental Mutation 'R7834:Mug2'
ID 605849
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Name murinoglobulin 2
Synonyms
MMRRC Submission 045888-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R7834 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 121983720-122062924 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 122013241 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 336 (I336T)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
AlphaFold P28666
Predicted Effect probably benign
Transcript: ENSMUST00000081777
AA Change: I336T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: I336T

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,115,068 (GRCm39) I626N probably damaging Het
Abcc12 T A 8: 87,258,179 (GRCm39) Y779F possibly damaging Het
Abcc12 C T 8: 87,284,859 (GRCm39) C252Y probably damaging Het
Adam22 A T 5: 8,180,535 (GRCm39) C521S probably damaging Het
Adcy5 C A 16: 34,977,570 (GRCm39) H368N probably benign Het
Akap13 T A 7: 75,392,390 (GRCm39) I2411N possibly damaging Het
Ankrd12 A G 17: 66,294,347 (GRCm39) F339S probably damaging Het
Bmp1 T A 14: 70,746,005 (GRCm39) R153W probably damaging Het
Bmp6 T C 13: 38,653,643 (GRCm39) F237L probably damaging Het
Cacna1c A G 6: 118,587,542 (GRCm39) S1628P Het
Ccdc141 T C 2: 76,889,889 (GRCm39) R468G possibly damaging Het
Cdc40 A T 10: 40,758,945 (GRCm39) S43T probably benign Het
Celf4 A G 18: 25,886,542 (GRCm39) M48T probably benign Het
Clec4g A T 8: 3,766,500 (GRCm39) M267K probably damaging Het
Col6a1 G T 10: 76,545,762 (GRCm39) S903R unknown Het
Creg2 A G 1: 39,689,802 (GRCm39) F103L probably damaging Het
Cul9 T C 17: 46,836,630 (GRCm39) probably null Het
Dchs1 G A 7: 105,414,774 (GRCm39) A756V probably benign Het
Diaph1 G A 18: 37,986,762 (GRCm39) probably benign Het
Dmxl1 G A 18: 50,054,044 (GRCm39) G2550D probably damaging Het
Dst G T 1: 34,233,186 (GRCm39) R3396I probably benign Het
Dync2h1 T C 9: 7,118,953 (GRCm39) T2171A probably benign Het
Fgd2 C T 17: 29,583,925 (GRCm39) T113M probably damaging Het
Galnt6 G T 15: 100,611,984 (GRCm39) S219R probably damaging Het
Gbp6 T A 5: 105,421,131 (GRCm39) E558V probably benign Het
Gnas A T 2: 174,140,783 (GRCm39) K377* probably null Het
Hars2 T C 18: 36,922,634 (GRCm39) I389T probably damaging Het
Hsp90ab1 T C 17: 45,882,091 (GRCm39) I123V possibly damaging Het
Igkv6-14 A T 6: 70,411,992 (GRCm39) N97K possibly damaging Het
Isg20 T C 7: 78,569,867 (GRCm39) L168P probably damaging Het
Kcna1 C T 6: 126,619,703 (GRCm39) D206N probably benign Het
Kcnn3 A G 3: 89,428,661 (GRCm39) I296V probably damaging Het
Kif18a G A 2: 109,127,119 (GRCm39) R351H probably damaging Het
Klra5 A T 6: 129,876,253 (GRCm39) probably null Het
Krt9 T C 11: 100,083,492 (GRCm39) T180A probably benign Het
Lhx8 T C 3: 154,017,174 (GRCm39) S323G probably null Het
Lpcat2 T A 8: 93,644,729 (GRCm39) L506H possibly damaging Het
Map2 A G 1: 66,455,647 (GRCm39) E1447G probably damaging Het
Mapk8ip2 A T 15: 89,345,576 (GRCm39) I779F probably damaging Het
Mcmdc2 G A 1: 9,982,399 (GRCm39) probably null Het
Mrps15 G A 4: 125,949,182 (GRCm39) E217K probably damaging Het
Muc5b G A 7: 141,412,807 (GRCm39) G1918R unknown Het
Myh10 T C 11: 68,676,652 (GRCm39) V878A probably damaging Het
Nomo1 T C 7: 45,706,162 (GRCm39) probably null Het
Ogdhl T A 14: 32,062,666 (GRCm39) I584N probably benign Het
Pdzrn3 G A 6: 101,128,156 (GRCm39) R837C probably damaging Het
Pkhd1 A G 1: 20,382,273 (GRCm39) M2626T probably benign Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Pml C A 9: 58,141,968 (GRCm39) R288L probably benign Het
Pnliprp2 T C 19: 58,762,591 (GRCm39) S399P probably benign Het
Prelp T C 1: 133,842,510 (GRCm39) T212A probably damaging Het
Ptpn13 T A 5: 103,610,014 (GRCm39) S4T probably damaging Het
Ptprb A C 10: 116,175,329 (GRCm39) E821A probably benign Het
Rabgap1 T C 2: 37,359,419 (GRCm39) probably benign Het
Reln C T 5: 22,244,633 (GRCm39) V782M possibly damaging Het
Rpl3l T C 17: 24,952,437 (GRCm39) V52A possibly damaging Het
Rrp1b T C 17: 32,270,698 (GRCm39) V219A probably benign Het
Rtn1 T A 12: 72,350,806 (GRCm39) I468F probably damaging Het
Safb T A 17: 56,900,881 (GRCm39) M129K unknown Het
Sall1 C A 8: 89,760,002 (GRCm39) S34I probably benign Het
Slc2a8 C T 2: 32,866,919 (GRCm39) G227D probably damaging Het
Slco4a1 G T 2: 180,107,470 (GRCm39) V295L probably benign Het
Slfn5 A T 11: 82,851,278 (GRCm39) Q525L possibly damaging Het
Speg C T 1: 75,361,571 (GRCm39) T195M probably damaging Het
Syne2 A T 12: 76,014,021 (GRCm39) T3071S probably benign Het
Syngr1 G T 15: 79,995,818 (GRCm39) W119L probably damaging Het
Tenm2 A G 11: 35,915,681 (GRCm39) L1951P probably damaging Het
Ulk4 C T 9: 121,092,734 (GRCm39) E168K possibly damaging Het
Ush2a G A 1: 188,465,637 (GRCm39) W2735* probably null Het
Usp17lb T A 7: 104,490,718 (GRCm39) T70S probably damaging Het
Vmn2r6 T G 3: 64,445,443 (GRCm39) N761H probably damaging Het
Vps13d A T 4: 144,835,143 (GRCm39) I2741K Het
Wdr38 A T 2: 38,890,196 (GRCm39) Q110L possibly damaging Het
Zfp872 A G 9: 22,111,406 (GRCm39) K295R probably damaging Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122,024,446 (GRCm39) missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122,017,613 (GRCm39) missense probably damaging 0.99
IGL01314:Mug2 APN 6 122,058,238 (GRCm39) missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122,026,587 (GRCm39) splice site probably benign
IGL01477:Mug2 APN 6 122,058,643 (GRCm39) splice site probably benign
IGL01926:Mug2 APN 6 122,013,063 (GRCm39) splice site probably benign
IGL02019:Mug2 APN 6 122,024,394 (GRCm39) missense probably benign 0.02
IGL02305:Mug2 APN 6 122,013,015 (GRCm39) missense probably benign
IGL02310:Mug2 APN 6 122,036,082 (GRCm39) splice site probably benign
IGL02484:Mug2 APN 6 122,049,712 (GRCm39) missense probably damaging 1.00
IGL02516:Mug2 APN 6 122,047,802 (GRCm39) missense probably damaging 1.00
IGL02531:Mug2 APN 6 122,049,730 (GRCm39) missense probably damaging 1.00
IGL02666:Mug2 APN 6 122,058,285 (GRCm39) missense probably damaging 1.00
IGL02936:Mug2 APN 6 122,058,346 (GRCm39) critical splice donor site probably null
R0114:Mug2 UTSW 6 122,017,607 (GRCm39) missense probably damaging 1.00
R0119:Mug2 UTSW 6 122,013,022 (GRCm39) missense probably benign 0.00
R0123:Mug2 UTSW 6 122,051,673 (GRCm39) missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122,047,970 (GRCm39) splice site probably benign
R0225:Mug2 UTSW 6 122,051,673 (GRCm39) missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122,058,558 (GRCm39) missense probably damaging 1.00
R0763:Mug2 UTSW 6 122,052,253 (GRCm39) missense probably benign
R0959:Mug2 UTSW 6 122,062,454 (GRCm39) missense probably benign 0.33
R1104:Mug2 UTSW 6 122,036,014 (GRCm39) missense probably benign
R1239:Mug2 UTSW 6 122,058,637 (GRCm39) splice site probably benign
R1318:Mug2 UTSW 6 122,054,361 (GRCm39) missense probably damaging 1.00
R1460:Mug2 UTSW 6 122,017,492 (GRCm39) splice site probably benign
R1706:Mug2 UTSW 6 122,013,191 (GRCm39) splice site probably benign
R1761:Mug2 UTSW 6 122,051,664 (GRCm39) missense probably benign 0.20
R1901:Mug2 UTSW 6 122,048,801 (GRCm39) missense probably benign 0.02
R1913:Mug2 UTSW 6 122,047,829 (GRCm39) missense probably damaging 1.00
R1943:Mug2 UTSW 6 122,056,598 (GRCm39) missense probably benign
R2054:Mug2 UTSW 6 122,054,451 (GRCm39) missense probably damaging 1.00
R2060:Mug2 UTSW 6 122,056,571 (GRCm39) missense probably benign
R2420:Mug2 UTSW 6 122,060,419 (GRCm39) missense probably damaging 1.00
R2432:Mug2 UTSW 6 122,061,335 (GRCm39) missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122,051,683 (GRCm39) splice site probably null
R2918:Mug2 UTSW 6 122,051,683 (GRCm39) splice site probably null
R3423:Mug2 UTSW 6 122,024,465 (GRCm39) splice site probably benign
R3834:Mug2 UTSW 6 122,026,746 (GRCm39) critical splice donor site probably null
R3902:Mug2 UTSW 6 122,052,526 (GRCm39) missense probably damaging 1.00
R3941:Mug2 UTSW 6 122,040,522 (GRCm39) missense probably benign
R4227:Mug2 UTSW 6 122,017,691 (GRCm39) missense probably benign 0.10
R4284:Mug2 UTSW 6 122,040,632 (GRCm39) missense probably benign 0.00
R4287:Mug2 UTSW 6 122,040,632 (GRCm39) missense probably benign 0.00
R4377:Mug2 UTSW 6 122,047,966 (GRCm39) critical splice donor site probably null
R4419:Mug2 UTSW 6 122,056,589 (GRCm39) missense probably damaging 1.00
R4498:Mug2 UTSW 6 122,059,711 (GRCm39) missense probably damaging 0.99
R4566:Mug2 UTSW 6 122,056,597 (GRCm39) missense probably benign 0.00
R4690:Mug2 UTSW 6 122,013,255 (GRCm39) missense probably benign
R4732:Mug2 UTSW 6 122,048,831 (GRCm39) missense probably damaging 0.99
R4733:Mug2 UTSW 6 122,048,831 (GRCm39) missense probably damaging 0.99
R4741:Mug2 UTSW 6 122,056,572 (GRCm39) missense probably benign
R4888:Mug2 UTSW 6 122,058,154 (GRCm39) missense probably damaging 1.00
R5199:Mug2 UTSW 6 122,017,619 (GRCm39) missense probably benign
R5347:Mug2 UTSW 6 122,058,551 (GRCm39) missense probably damaging 1.00
R5457:Mug2 UTSW 6 122,026,688 (GRCm39) nonsense probably null
R5495:Mug2 UTSW 6 122,056,609 (GRCm39) missense probably damaging 0.96
R5509:Mug2 UTSW 6 122,061,340 (GRCm39) missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122,060,459 (GRCm39) missense probably null 0.98
R6180:Mug2 UTSW 6 122,056,565 (GRCm39) missense probably benign 0.01
R6184:Mug2 UTSW 6 122,014,005 (GRCm39) missense probably benign
R6199:Mug2 UTSW 6 122,024,398 (GRCm39) missense probably benign 0.05
R6262:Mug2 UTSW 6 122,052,214 (GRCm39) missense probably damaging 1.00
R6416:Mug2 UTSW 6 122,059,713 (GRCm39) missense probably damaging 1.00
R6548:Mug2 UTSW 6 122,024,401 (GRCm39) missense probably damaging 1.00
R6703:Mug2 UTSW 6 122,055,653 (GRCm39) missense probably benign 0.25
R7106:Mug2 UTSW 6 122,059,680 (GRCm39) missense probably damaging 1.00
R7131:Mug2 UTSW 6 122,052,206 (GRCm39) missense probably damaging 1.00
R7372:Mug2 UTSW 6 122,060,425 (GRCm39) missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122,024,446 (GRCm39) missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122,017,529 (GRCm39) missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122,056,685 (GRCm39) missense probably benign 0.00
R7581:Mug2 UTSW 6 122,040,670 (GRCm39) missense probably damaging 1.00
R7582:Mug2 UTSW 6 122,056,603 (GRCm39) missense probably damaging 0.99
R7672:Mug2 UTSW 6 122,017,678 (GRCm39) missense probably benign 0.37
R7713:Mug2 UTSW 6 122,055,754 (GRCm39) missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122,058,317 (GRCm39) missense probably damaging 1.00
R7850:Mug2 UTSW 6 122,052,170 (GRCm39) missense probably damaging 1.00
R8029:Mug2 UTSW 6 122,058,504 (GRCm39) critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122,052,567 (GRCm39) missense probably benign 0.01
R8335:Mug2 UTSW 6 122,017,543 (GRCm39) missense probably benign
R8348:Mug2 UTSW 6 122,049,192 (GRCm39) nonsense probably null
R8557:Mug2 UTSW 6 122,040,660 (GRCm39) missense probably damaging 0.99
R8798:Mug2 UTSW 6 122,058,569 (GRCm39) missense probably damaging 1.00
R8823:Mug2 UTSW 6 122,040,648 (GRCm39) missense possibly damaging 0.89
R9029:Mug2 UTSW 6 122,061,328 (GRCm39) missense probably damaging 1.00
R9153:Mug2 UTSW 6 122,017,627 (GRCm39) missense possibly damaging 0.71
R9185:Mug2 UTSW 6 122,054,442 (GRCm39) missense probably benign 0.06
R9186:Mug2 UTSW 6 122,052,248 (GRCm39) missense probably damaging 0.99
R9418:Mug2 UTSW 6 122,017,700 (GRCm39) missense probably benign 0.00
R9464:Mug2 UTSW 6 122,028,690 (GRCm39) missense probably benign 0.01
R9622:Mug2 UTSW 6 122,028,751 (GRCm39) missense probably benign 0.29
Z1177:Mug2 UTSW 6 122,014,080 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATGTGAATGCAACTGTTACAG -3'
(R):5'- CTTGTGTTGCAATCAATGATGTCAG -3'

Sequencing Primer
(F):5'- TGTGAATGCAACTGTTACAGAAGAAG -3'
(R):5'- GCAATCAATGATGTCAGACATGC -3'
Posted On 2019-12-20