Incidental Mutation 'R7834:Akap13'

• ID: 605853
• Institutional Source: Beutler Lab
• Gene Symbol: Akap13
• Ensembl Gene: ENSMUSG00000066406
• Gene Name: A kinase (PRKA) anchor protein 13
• Synonyms: AKAP-Lbc, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, PROTO-LB, Ht31, 5830460E08Rik
• MMRRC Submission: 045888-MU
• Essential gene?: Essential (E-score: 1.000)
• Stock #: R7834 (G1)
• Quality Score: 225.009
• Status: Validated
• Chromosome: 7
• Chromosomal Location: 75455534-75754609 bp(+) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): T to A at 75742642 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Isoleucine to Asparagine at position 2411 (I2411N)
• Ref Sequence: ENSEMBL: ENSMUSP00000147237
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207750]
• AlphaFold: no structure available at present
• Predicted Effect: possibly damaging; Transcript: ENSMUST00000166315; AA Change: I2393N; PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
• SMART Domains: Protein: ENSMUSP00000129784; Gene: ENSMUSG00000066406; AA Change: I2393N

Domain	Start	End	E-Value	Type
low complexity region	174	184	N/A	INTRINSIC
low complexity region	773	789	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1021	1032	N/A	INTRINSIC
low complexity region	1433	1448	N/A	INTRINSIC
low complexity region	1483	1505	N/A	INTRINSIC
low complexity region	1583	1594	N/A	INTRINSIC
low complexity region	1720	1750	N/A	INTRINSIC
C1	1755	1801	1.95e-4	SMART
low complexity region	1858	1869	N/A	INTRINSIC
RhoGEF	1961	2153	1.28e-61	SMART
PH	2195	2298	2.94e-11	SMART
coiled coil region	2308	2345	N/A	INTRINSIC
low complexity region	2393	2412	N/A	INTRINSIC
low complexity region	2444	2454	N/A	INTRINSIC
coiled coil region	2533	2646	N/A	INTRINSIC
low complexity region	2728	2734	N/A	INTRINSIC
low complexity region	2740	2753	N/A	INTRINSIC

• Predicted Effect: possibly damaging; Transcript: ENSMUST00000207750; AA Change: I2411N; PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
• Coding Region Coverage:
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
• Validation Efficiency: 100% (75/75)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012] ; PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]
• Posted On: 2019-12-20

Predicted Primers

PCR Primer
(F):5'- TCCCAGTAGATTACTCCGCC -3'
(R):5'- GAGCTACCAGAATCCAGGTC -3'

Sequencing Primer
(F):5'- CCAGTAGATTACTCCGCCATTTG -3'
(R):5'- GGTCACCATGAACTGCAATG -3'