Incidental Mutation 'R7834:Akap13'
ID605853
Institutional Source Beutler Lab
Gene Symbol Akap13
Ensembl Gene ENSMUSG00000066406
Gene NameA kinase (PRKA) anchor protein 13
SynonymsAKAP-Lbc, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, PROTO-LB, Ht31, 5830460E08Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7834 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location75455534-75754609 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75742642 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 2411 (I2411N)
Ref Sequence ENSEMBL: ENSMUSP00000147237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207750]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166315
AA Change: I2393N

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: I2393N

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
low complexity region 1433 1448 N/A INTRINSIC
low complexity region 1483 1505 N/A INTRINSIC
low complexity region 1583 1594 N/A INTRINSIC
low complexity region 1720 1750 N/A INTRINSIC
C1 1755 1801 1.95e-4 SMART
low complexity region 1858 1869 N/A INTRINSIC
RhoGEF 1961 2153 1.28e-61 SMART
PH 2195 2298 2.94e-11 SMART
coiled coil region 2308 2345 N/A INTRINSIC
low complexity region 2393 2412 N/A INTRINSIC
low complexity region 2444 2454 N/A INTRINSIC
coiled coil region 2533 2646 N/A INTRINSIC
low complexity region 2728 2734 N/A INTRINSIC
low complexity region 2740 2753 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000207750
AA Change: I2411N

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,284,724 I626N probably damaging Het
Abcc12 T A 8: 86,531,550 Y779F possibly damaging Het
Abcc12 C T 8: 86,558,230 C252Y probably damaging Het
Adam22 A T 5: 8,130,535 C521S probably damaging Het
Adcy5 C A 16: 35,157,200 H368N probably benign Het
Ankrd12 A G 17: 65,987,352 F339S probably damaging Het
Bmp1 T A 14: 70,508,565 R153W probably damaging Het
Bmp6 T C 13: 38,469,667 F237L probably damaging Het
Cacna1c A G 6: 118,610,581 S1628P Het
Ccdc141 T C 2: 77,059,545 R468G possibly damaging Het
Cdc40 A T 10: 40,882,949 S43T probably benign Het
Celf4 A G 18: 25,753,485 M48T probably benign Het
Clec4g A T 8: 3,716,500 M267K probably damaging Het
Col6a1 G T 10: 76,709,928 S903R unknown Het
Creg2 A G 1: 39,650,634 F103L probably damaging Het
Cul9 T C 17: 46,525,704 probably null Het
Dchs1 G A 7: 105,765,567 A756V probably benign Het
Diaph1 G A 18: 37,853,709 probably benign Het
Dmxl1 G A 18: 49,920,977 G2550D probably damaging Het
Dst G T 1: 34,194,105 R3396I probably benign Het
Dync2h1 T C 9: 7,118,953 T2171A probably benign Het
Fgd2 C T 17: 29,364,951 T113M probably damaging Het
Galnt6 G T 15: 100,714,103 S219R probably damaging Het
Gbp6 T A 5: 105,273,265 E558V probably benign Het
Gnas A T 2: 174,298,990 K377* probably null Het
Hars2 T C 18: 36,789,581 I389T probably damaging Het
Hsp90ab1 T C 17: 45,571,165 I123V possibly damaging Het
Igkv6-14 A T 6: 70,435,008 N97K possibly damaging Het
Isg20 T C 7: 78,920,119 L168P probably damaging Het
Kcna1 C T 6: 126,642,740 D206N probably benign Het
Kcnn3 A G 3: 89,521,354 I296V probably damaging Het
Kif18a G A 2: 109,296,774 R351H probably damaging Het
Klra5 A T 6: 129,899,290 probably null Het
Krt9 T C 11: 100,192,666 T180A probably benign Het
Lhx8 T C 3: 154,311,537 S323G probably null Het
Lpcat2 T A 8: 92,918,101 L506H possibly damaging Het
Map2 A G 1: 66,416,488 E1447G probably damaging Het
Mapk8ip2 A T 15: 89,461,373 I779F probably damaging Het
Mcmdc2 G A 1: 9,912,174 probably null Het
Mrps15 G A 4: 126,055,389 E217K probably damaging Het
Muc5b G A 7: 141,859,070 G1918R unknown Het
Mug2 T C 6: 122,036,282 I336T probably benign Het
Myh10 T C 11: 68,785,826 V878A probably damaging Het
Nomo1 T C 7: 46,056,738 probably null Het
Ogdhl T A 14: 32,340,709 I584N probably benign Het
Pdzrn3 G A 6: 101,151,195 R837C probably damaging Het
Pkhd1 A G 1: 20,312,049 M2626T probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Pnliprp2 T C 19: 58,774,159 S399P probably benign Het
Prelp T C 1: 133,914,772 T212A probably damaging Het
Ptpn13 T A 5: 103,462,148 S4T probably damaging Het
Ptprb A C 10: 116,339,424 E821A probably benign Het
Rabgap1 T C 2: 37,469,407 probably benign Het
Reln C T 5: 22,039,635 V782M possibly damaging Het
Rpl3l T C 17: 24,733,463 V52A possibly damaging Het
Rrp1b T C 17: 32,051,724 V219A probably benign Het
Rtn1 T A 12: 72,304,032 I468F probably damaging Het
Safb T A 17: 56,593,881 M129K unknown Het
Sall1 C A 8: 89,033,374 S34I probably benign Het
Slc2a8 C T 2: 32,976,907 G227D probably damaging Het
Slco4a1 G T 2: 180,465,677 V295L probably benign Het
Slfn5 A T 11: 82,960,452 Q525L possibly damaging Het
Speg C T 1: 75,384,927 T195M probably damaging Het
Syne2 A T 12: 75,967,247 T3071S probably benign Het
Syngr1 G T 15: 80,111,617 W119L probably damaging Het
Tenm2 A G 11: 36,024,854 L1951P probably damaging Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Ush2a G A 1: 188,733,440 W2735* probably null Het
Usp17lb T A 7: 104,841,511 T70S probably damaging Het
Vmn2r6 T G 3: 64,538,022 N761H probably damaging Het
Vps13d A T 4: 145,108,573 I2741K Het
Wdr38 A T 2: 39,000,184 Q110L possibly damaging Het
Zfp872 A G 9: 22,200,110 K295R probably damaging Het
Other mutations in Akap13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Akap13 APN 7 75725971 missense probably damaging 0.99
IGL00332:Akap13 APN 7 75728919 missense probably damaging 1.00
IGL00481:Akap13 APN 7 75723895 missense probably damaging 1.00
IGL00590:Akap13 APN 7 75610669 missense probably benign 0.01
IGL00655:Akap13 APN 7 75704398 missense probably damaging 0.99
IGL00766:Akap13 APN 7 75704512 missense probably damaging 0.96
IGL00818:Akap13 APN 7 75609727 missense probably benign 0.00
IGL00826:Akap13 APN 7 75677447 missense probably damaging 1.00
IGL01014:Akap13 APN 7 75750633 utr 3 prime probably benign
IGL01090:Akap13 APN 7 75666531 missense probably benign 0.44
IGL01155:Akap13 APN 7 75569936 missense probably damaging 1.00
IGL01326:Akap13 APN 7 75725348 missense probably benign 0.30
IGL01456:Akap13 APN 7 75602847 missense probably damaging 0.98
IGL01460:Akap13 APN 7 75747846 missense probably benign 0.29
IGL01568:Akap13 APN 7 75608522 nonsense probably null 0.00
IGL01610:Akap13 APN 7 75720180 missense possibly damaging 0.71
IGL01610:Akap13 APN 7 75747605 missense probably damaging 1.00
IGL01615:Akap13 APN 7 75697393 missense probably damaging 1.00
IGL01667:Akap13 APN 7 75570019 missense probably damaging 1.00
IGL01705:Akap13 APN 7 75746767 missense possibly damaging 0.86
IGL02070:Akap13 APN 7 75666545 missense probably benign 0.27
IGL02269:Akap13 APN 7 75602911 missense probably benign
IGL02421:Akap13 APN 7 75717806 missense possibly damaging 0.66
IGL02870:Akap13 APN 7 75609188 missense probably damaging 0.96
IGL02944:Akap13 APN 7 75608657 missense probably benign
IGL03051:Akap13 APN 7 75610485 nonsense probably null
IGL03160:Akap13 APN 7 75730417 missense probably damaging 1.00
IGL03245:Akap13 APN 7 75609752 missense probably damaging 0.99
R0254:Akap13 UTSW 7 75736604 splice site probably benign
R0310:Akap13 UTSW 7 75614930 missense probably damaging 0.99
R0373:Akap13 UTSW 7 75609929 missense probably benign 0.00
R0373:Akap13 UTSW 7 75730500 missense probably damaging 1.00
R0408:Akap13 UTSW 7 75746796 missense probably damaging 1.00
R0631:Akap13 UTSW 7 75614996 missense probably damaging 0.99
R0646:Akap13 UTSW 7 75747746 missense probably damaging 1.00
R0781:Akap13 UTSW 7 75611377 missense possibly damaging 0.56
R0845:Akap13 UTSW 7 75725380 missense probably damaging 1.00
R1004:Akap13 UTSW 7 75687286 missense probably damaging 0.99
R1024:Akap13 UTSW 7 75677409 missense probably damaging 1.00
R1110:Akap13 UTSW 7 75611377 missense possibly damaging 0.56
R1346:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1349:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1372:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1387:Akap13 UTSW 7 75586193 missense probably damaging 0.97
R1442:Akap13 UTSW 7 75735778 missense probably damaging 0.99
R1466:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1466:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1584:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1696:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1738:Akap13 UTSW 7 75677194 missense probably damaging 1.00
R1773:Akap13 UTSW 7 75683451 missense possibly damaging 0.80
R1785:Akap13 UTSW 7 75611434 missense probably benign 0.16
R1786:Akap13 UTSW 7 75611434 missense probably benign 0.16
R1791:Akap13 UTSW 7 75611035 missense probably benign 0.00
R1819:Akap13 UTSW 7 75608705 missense probably benign 0.04
R1879:Akap13 UTSW 7 75610727 missense probably benign 0.01
R1989:Akap13 UTSW 7 75704516 missense probably benign 0.01
R2016:Akap13 UTSW 7 75704531 missense probably damaging 0.99
R2092:Akap13 UTSW 7 75610570 missense probably benign 0.05
R2126:Akap13 UTSW 7 75725304 missense possibly damaging 0.95
R2131:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2132:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2133:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2251:Akap13 UTSW 7 75739477 missense possibly damaging 0.50
R3704:Akap13 UTSW 7 75666550 missense probably damaging 1.00
R3713:Akap13 UTSW 7 75586181 missense probably damaging 0.98
R3731:Akap13 UTSW 7 75611377 missense probably benign 0.39
R3765:Akap13 UTSW 7 75608837 missense probably benign 0.04
R3788:Akap13 UTSW 7 75702153 critical splice donor site probably null
R3793:Akap13 UTSW 7 75610141 missense probably benign 0.00
R3970:Akap13 UTSW 7 75569951 nonsense probably null
R4205:Akap13 UTSW 7 75610919 missense probably benign 0.05
R4257:Akap13 UTSW 7 75611285 missense probably damaging 0.98
R4374:Akap13 UTSW 7 75608984 missense probably damaging 0.96
R4448:Akap13 UTSW 7 75742760 missense probably damaging 1.00
R4450:Akap13 UTSW 7 75742760 missense probably damaging 1.00
R4457:Akap13 UTSW 7 75739465 missense probably damaging 0.99
R4458:Akap13 UTSW 7 75739465 missense probably damaging 0.99
R4466:Akap13 UTSW 7 75602773 splice site probably null
R4632:Akap13 UTSW 7 75666553 missense possibly damaging 0.91
R4667:Akap13 UTSW 7 75729094 missense probably damaging 1.00
R4669:Akap13 UTSW 7 75729094 missense probably damaging 1.00
R4671:Akap13 UTSW 7 75579564 nonsense probably null
R4821:Akap13 UTSW 7 75677507 intron probably benign
R4868:Akap13 UTSW 7 75743504 missense probably damaging 1.00
R4894:Akap13 UTSW 7 75725320 missense possibly damaging 0.76
R4943:Akap13 UTSW 7 75749240 missense probably benign 0.22
R4962:Akap13 UTSW 7 75749430 missense probably damaging 0.98
R4988:Akap13 UTSW 7 75730528 missense probably damaging 1.00
R5119:Akap13 UTSW 7 75687252 missense probably damaging 0.98
R5141:Akap13 UTSW 7 75609614 missense probably benign 0.18
R5419:Akap13 UTSW 7 75610243 missense probably benign 0.01
R5427:Akap13 UTSW 7 75728869 missense possibly damaging 0.89
R5429:Akap13 UTSW 7 75602904 missense possibly damaging 0.70
R5432:Akap13 UTSW 7 75602830 missense probably damaging 1.00
R5458:Akap13 UTSW 7 75586301 missense probably damaging 1.00
R5636:Akap13 UTSW 7 75704372 missense probably damaging 0.96
R5643:Akap13 UTSW 7 75702154 critical splice donor site probably null
R5898:Akap13 UTSW 7 75729146 missense probably damaging 1.00
R5932:Akap13 UTSW 7 75610184 missense probably damaging 1.00
R6135:Akap13 UTSW 7 75609908 missense possibly damaging 0.94
R6137:Akap13 UTSW 7 75677416 missense probably damaging 1.00
R6182:Akap13 UTSW 7 75586280 missense probably benign 0.45
R6310:Akap13 UTSW 7 75749193 missense probably damaging 0.99
R6346:Akap13 UTSW 7 75685254 missense probably damaging 1.00
R6466:Akap13 UTSW 7 75727044 missense probably benign 0.01
R6605:Akap13 UTSW 7 75579768 missense probably damaging 0.98
R6617:Akap13 UTSW 7 75730363 missense possibly damaging 0.95
R6621:Akap13 UTSW 7 75569981 missense probably damaging 1.00
R6703:Akap13 UTSW 7 75602898 missense probably damaging 1.00
R6750:Akap13 UTSW 7 75739458 missense probably benign 0.03
R7069:Akap13 UTSW 7 75610262 missense probably benign 0.29
R7116:Akap13 UTSW 7 75720195 missense probably benign 0.00
R7158:Akap13 UTSW 7 75579594 missense probably damaging 0.97
R7159:Akap13 UTSW 7 75730579 missense possibly damaging 0.72
R7467:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7468:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7471:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7472:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7477:Akap13 UTSW 7 75749247 missense probably benign
R7636:Akap13 UTSW 7 75609873 missense probably benign 0.04
R7650:Akap13 UTSW 7 75643454 missense probably benign 0.20
R7671:Akap13 UTSW 7 75569900 missense probably damaging 1.00
R7681:Akap13 UTSW 7 75728796 missense possibly damaging 0.91
R7752:Akap13 UTSW 7 75677258 missense possibly damaging 0.74
R7784:Akap13 UTSW 7 75610328 missense probably benign 0.00
R7816:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7817:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7880:Akap13 UTSW 7 75586216 missense probably damaging 0.97
R8006:Akap13 UTSW 7 75579696 missense probably damaging 1.00
R8009:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8011:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8012:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8013:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8016:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8089:Akap13 UTSW 7 75610592 missense possibly damaging 0.94
R8174:Akap13 UTSW 7 75728869 missense possibly damaging 0.89
R8298:Akap13 UTSW 7 75747804 missense probably damaging 1.00
Z1176:Akap13 UTSW 7 75730552 missense probably damaging 0.99
Z1177:Akap13 UTSW 7 75615005 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCCCAGTAGATTACTCCGCC -3'
(R):5'- GAGCTACCAGAATCCAGGTC -3'

Sequencing Primer
(F):5'- CCAGTAGATTACTCCGCCATTTG -3'
(R):5'- GGTCACCATGAACTGCAATG -3'
Posted On2019-12-20