Incidental Mutation 'R7834:Dchs1'
ID605856
Institutional Source Beutler Lab
Gene Symbol Dchs1
Ensembl Gene ENSMUSG00000036862
Gene Namedachsous cadherin related 1
Synonyms3110041P15Rik, C130033F22Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7834 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location105752990-105787654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105765567 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 756 (A756V)
Ref Sequence ENSEMBL: ENSMUSP00000077574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078482]
Predicted Effect probably benign
Transcript: ENSMUST00000078482
AA Change: A756V

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: A756V

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CA 58 135 5.2e-11 SMART
CA 159 247 6.1e-17 SMART
CA 271 354 2.6e-30 SMART
CA 382 464 7.8e-26 SMART
CA 489 570 1.2e-34 SMART
CA 594 677 1.9e-27 SMART
CA 701 782 5.3e-11 SMART
CA 806 886 1e-12 SMART
CA 910 990 3.3e-14 SMART
CA 1016 1097 3.6e-18 SMART
CA 1121 1203 3.1e-34 SMART
CA 1233 1307 8.8e-16 SMART
low complexity region 1323 1335 N/A INTRINSIC
CA 1344 1427 9.9e-9 SMART
CA 1451 1537 1.5e-23 SMART
CA 1560 1640 7.2e-32 SMART
CA 1664 1742 1.8e-31 SMART
CA 1765 1846 7.8e-30 SMART
CA 1870 1951 3.7e-26 SMART
low complexity region 1957 1965 N/A INTRINSIC
CA 1979 2059 1.1e-6 SMART
CA 2083 2162 2.7e-18 SMART
CA 2186 2268 2.2e-26 SMART
CA 2291 2367 1e-18 SMART
CA 2391 2473 1.8e-23 SMART
CA 2497 2593 3.5e-21 SMART
CA 2617 2697 1.2e-25 SMART
CA 2721 2804 1.9e-18 SMART
CA 2828 2919 3e-3 SMART
transmembrane domain 2932 2954 N/A INTRINSIC
low complexity region 3001 3017 N/A INTRINSIC
low complexity region 3046 3055 N/A INTRINSIC
low complexity region 3088 3097 N/A INTRINSIC
low complexity region 3185 3196 N/A INTRINSIC
low complexity region 3237 3259 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,284,724 I626N probably damaging Het
Abcc12 T A 8: 86,531,550 Y779F possibly damaging Het
Abcc12 C T 8: 86,558,230 C252Y probably damaging Het
Adam22 A T 5: 8,130,535 C521S probably damaging Het
Adcy5 C A 16: 35,157,200 H368N probably benign Het
Akap13 T A 7: 75,742,642 I2411N possibly damaging Het
Ankrd12 A G 17: 65,987,352 F339S probably damaging Het
Bmp1 T A 14: 70,508,565 R153W probably damaging Het
Bmp6 T C 13: 38,469,667 F237L probably damaging Het
Cacna1c A G 6: 118,610,581 S1628P Het
Ccdc141 T C 2: 77,059,545 R468G possibly damaging Het
Cdc40 A T 10: 40,882,949 S43T probably benign Het
Celf4 A G 18: 25,753,485 M48T probably benign Het
Clec4g A T 8: 3,716,500 M267K probably damaging Het
Col6a1 G T 10: 76,709,928 S903R unknown Het
Creg2 A G 1: 39,650,634 F103L probably damaging Het
Cul9 T C 17: 46,525,704 probably null Het
Diaph1 G A 18: 37,853,709 probably benign Het
Dmxl1 G A 18: 49,920,977 G2550D probably damaging Het
Dst G T 1: 34,194,105 R3396I probably benign Het
Dync2h1 T C 9: 7,118,953 T2171A probably benign Het
Fgd2 C T 17: 29,364,951 T113M probably damaging Het
Galnt6 G T 15: 100,714,103 S219R probably damaging Het
Gbp6 T A 5: 105,273,265 E558V probably benign Het
Gnas A T 2: 174,298,990 K377* probably null Het
Hars2 T C 18: 36,789,581 I389T probably damaging Het
Hsp90ab1 T C 17: 45,571,165 I123V possibly damaging Het
Igkv6-14 A T 6: 70,435,008 N97K possibly damaging Het
Isg20 T C 7: 78,920,119 L168P probably damaging Het
Kcna1 C T 6: 126,642,740 D206N probably benign Het
Kcnn3 A G 3: 89,521,354 I296V probably damaging Het
Kif18a G A 2: 109,296,774 R351H probably damaging Het
Klra5 A T 6: 129,899,290 probably null Het
Krt9 T C 11: 100,192,666 T180A probably benign Het
Lhx8 T C 3: 154,311,537 S323G probably null Het
Lpcat2 T A 8: 92,918,101 L506H possibly damaging Het
Map2 A G 1: 66,416,488 E1447G probably damaging Het
Mapk8ip2 A T 15: 89,461,373 I779F probably damaging Het
Mcmdc2 G A 1: 9,912,174 probably null Het
Mrps15 G A 4: 126,055,389 E217K probably damaging Het
Muc5b G A 7: 141,859,070 G1918R unknown Het
Mug2 T C 6: 122,036,282 I336T probably benign Het
Myh10 T C 11: 68,785,826 V878A probably damaging Het
Nomo1 T C 7: 46,056,738 probably null Het
Ogdhl T A 14: 32,340,709 I584N probably benign Het
Pdzrn3 G A 6: 101,151,195 R837C probably damaging Het
Pkhd1 A G 1: 20,312,049 M2626T probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pml C A 9: 58,234,685 R288L probably benign Het
Pnliprp2 T C 19: 58,774,159 S399P probably benign Het
Prelp T C 1: 133,914,772 T212A probably damaging Het
Ptpn13 T A 5: 103,462,148 S4T probably damaging Het
Ptprb A C 10: 116,339,424 E821A probably benign Het
Rabgap1 T C 2: 37,469,407 probably benign Het
Reln C T 5: 22,039,635 V782M possibly damaging Het
Rpl3l T C 17: 24,733,463 V52A possibly damaging Het
Rrp1b T C 17: 32,051,724 V219A probably benign Het
Rtn1 T A 12: 72,304,032 I468F probably damaging Het
Safb T A 17: 56,593,881 M129K unknown Het
Sall1 C A 8: 89,033,374 S34I probably benign Het
Slc2a8 C T 2: 32,976,907 G227D probably damaging Het
Slco4a1 G T 2: 180,465,677 V295L probably benign Het
Slfn5 A T 11: 82,960,452 Q525L possibly damaging Het
Speg C T 1: 75,384,927 T195M probably damaging Het
Syne2 A T 12: 75,967,247 T3071S probably benign Het
Syngr1 G T 15: 80,111,617 W119L probably damaging Het
Tenm2 A G 11: 36,024,854 L1951P probably damaging Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Ush2a G A 1: 188,733,440 W2735* probably null Het
Usp17lb T A 7: 104,841,511 T70S probably damaging Het
Vmn2r6 T G 3: 64,538,022 N761H probably damaging Het
Vps13d A T 4: 145,108,573 I2741K Het
Wdr38 A T 2: 39,000,184 Q110L possibly damaging Het
Zfp872 A G 9: 22,200,110 K295R probably damaging Het
Other mutations in Dchs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Dchs1 APN 7 105758743 missense probably damaging 1.00
IGL00422:Dchs1 APN 7 105758029 missense possibly damaging 0.88
IGL00427:Dchs1 APN 7 105758424 missense probably damaging 0.98
IGL00469:Dchs1 APN 7 105755261 missense probably damaging 1.00
IGL00470:Dchs1 APN 7 105758207 missense probably damaging 1.00
IGL00534:Dchs1 APN 7 105757943 missense probably benign
IGL01292:Dchs1 APN 7 105760891 missense probably damaging 0.98
IGL01380:Dchs1 APN 7 105762211 missense probably damaging 1.00
IGL01396:Dchs1 APN 7 105772283 missense probably damaging 1.00
IGL01448:Dchs1 APN 7 105771927 missense probably damaging 0.98
IGL01759:Dchs1 APN 7 105755302 missense probably benign 0.00
IGL01829:Dchs1 APN 7 105755397 missense probably damaging 0.99
IGL01946:Dchs1 APN 7 105759105 missense probably damaging 1.00
IGL01955:Dchs1 APN 7 105757591 missense probably benign 0.00
IGL02012:Dchs1 APN 7 105764297 missense probably damaging 0.98
IGL02222:Dchs1 APN 7 105764887 missense probably damaging 1.00
IGL02261:Dchs1 APN 7 105772569 missense probably damaging 1.00
IGL02365:Dchs1 APN 7 105755188 missense probably benign 0.22
IGL02430:Dchs1 APN 7 105771971 missense probably benign 0.34
IGL02500:Dchs1 APN 7 105755806 missense probably benign
IGL02741:Dchs1 APN 7 105757323 missense probably damaging 1.00
IGL02890:Dchs1 APN 7 105756491 missense probably damaging 1.00
IGL03213:Dchs1 APN 7 105755072 missense probably damaging 1.00
P0026:Dchs1 UTSW 7 105758405 missense probably damaging 0.99
PIT4377001:Dchs1 UTSW 7 105757588 missense probably damaging 1.00
PIT4791001:Dchs1 UTSW 7 105758971 missense probably damaging 1.00
R0013:Dchs1 UTSW 7 105755836 missense possibly damaging 0.90
R0090:Dchs1 UTSW 7 105755932 missense probably benign 0.18
R0091:Dchs1 UTSW 7 105766094 splice site probably benign
R0193:Dchs1 UTSW 7 105764983 missense probably benign 0.40
R0395:Dchs1 UTSW 7 105758538 missense probably damaging 1.00
R0448:Dchs1 UTSW 7 105765927 missense probably benign 0.00
R0480:Dchs1 UTSW 7 105771489 missense probably benign 0.14
R0485:Dchs1 UTSW 7 105772727 missense probably benign 0.00
R0566:Dchs1 UTSW 7 105759195 missense probably benign 0.00
R0571:Dchs1 UTSW 7 105771996 missense probably damaging 1.00
R0573:Dchs1 UTSW 7 105758778 missense probably damaging 0.98
R0577:Dchs1 UTSW 7 105764255 missense possibly damaging 0.78
R0622:Dchs1 UTSW 7 105763449 missense probably damaging 1.00
R0654:Dchs1 UTSW 7 105772349 missense probably damaging 1.00
R0677:Dchs1 UTSW 7 105764984 missense probably damaging 1.00
R1171:Dchs1 UTSW 7 105757714 missense probably benign
R1241:Dchs1 UTSW 7 105758178 missense probably damaging 1.00
R1389:Dchs1 UTSW 7 105755571 missense probably benign 0.40
R1427:Dchs1 UTSW 7 105766191 missense probably benign 0.06
R1458:Dchs1 UTSW 7 105755244 missense probably damaging 1.00
R1513:Dchs1 UTSW 7 105772071 nonsense probably null
R1524:Dchs1 UTSW 7 105764525 missense probably damaging 1.00
R1525:Dchs1 UTSW 7 105758931 missense probably damaging 1.00
R1534:Dchs1 UTSW 7 105772040 missense probably damaging 0.98
R1567:Dchs1 UTSW 7 105771861 missense probably benign 0.01
R1577:Dchs1 UTSW 7 105765955 missense probably damaging 1.00
R1603:Dchs1 UTSW 7 105762770 missense probably benign 0.24
R1676:Dchs1 UTSW 7 105754921 missense probably benign 0.40
R1794:Dchs1 UTSW 7 105771720 missense probably benign 0.02
R1826:Dchs1 UTSW 7 105757627 missense probably damaging 1.00
R1892:Dchs1 UTSW 7 105764156 missense probably benign 0.00
R1924:Dchs1 UTSW 7 105772280 missense possibly damaging 0.81
R1932:Dchs1 UTSW 7 105765902 missense probably damaging 1.00
R1962:Dchs1 UTSW 7 105764201 missense probably damaging 1.00
R1985:Dchs1 UTSW 7 105772398 missense possibly damaging 0.72
R1993:Dchs1 UTSW 7 105762548 missense probably benign 0.00
R2007:Dchs1 UTSW 7 105755325 missense probably damaging 1.00
R2316:Dchs1 UTSW 7 105764204 missense possibly damaging 0.71
R2351:Dchs1 UTSW 7 105754094 missense probably benign
R2474:Dchs1 UTSW 7 105755074 missense probably benign 0.37
R2474:Dchs1 UTSW 7 105772838 missense probably damaging 1.00
R3429:Dchs1 UTSW 7 105756504 missense possibly damaging 0.85
R3430:Dchs1 UTSW 7 105756504 missense possibly damaging 0.85
R3737:Dchs1 UTSW 7 105762316 missense possibly damaging 0.88
R3767:Dchs1 UTSW 7 105757085 missense possibly damaging 0.67
R3874:Dchs1 UTSW 7 105761635 missense probably damaging 1.00
R3883:Dchs1 UTSW 7 105762563 missense probably damaging 1.00
R4105:Dchs1 UTSW 7 105765140 missense probably damaging 1.00
R4209:Dchs1 UTSW 7 105766190 missense probably damaging 0.99
R4329:Dchs1 UTSW 7 105753759 missense probably damaging 1.00
R4516:Dchs1 UTSW 7 105754852 missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105754765 missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105758973 missense probably benign
R4588:Dchs1 UTSW 7 105756041 missense probably benign
R4613:Dchs1 UTSW 7 105772724 missense probably damaging 1.00
R4632:Dchs1 UTSW 7 105754355 missense probably benign 0.02
R4696:Dchs1 UTSW 7 105764627 missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105755253 missense probably damaging 0.98
R4725:Dchs1 UTSW 7 105765552 missense probably damaging 1.00
R4738:Dchs1 UTSW 7 105758673 missense probably damaging 0.96
R4768:Dchs1 UTSW 7 105771620 missense possibly damaging 0.96
R4784:Dchs1 UTSW 7 105765926 missense probably damaging 1.00
R4864:Dchs1 UTSW 7 105755253 missense probably damaging 0.98
R4880:Dchs1 UTSW 7 105755730 missense probably benign 0.00
R4909:Dchs1 UTSW 7 105766255 missense probably damaging 1.00
R5102:Dchs1 UTSW 7 105772177 missense probably benign 0.09
R5109:Dchs1 UTSW 7 105765014 missense probably benign
R5126:Dchs1 UTSW 7 105753517 missense probably damaging 1.00
R5149:Dchs1 UTSW 7 105755658 missense probably damaging 0.98
R5330:Dchs1 UTSW 7 105754602 missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105758029 missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105772055 missense probably damaging 1.00
R5386:Dchs1 UTSW 7 105758029 missense probably damaging 1.00
R5622:Dchs1 UTSW 7 105755293 missense probably benign 0.11
R5623:Dchs1 UTSW 7 105772769 missense probably damaging 1.00
R5708:Dchs1 UTSW 7 105772809 missense probably damaging 1.00
R5718:Dchs1 UTSW 7 105755748 missense probably benign 0.01
R5743:Dchs1 UTSW 7 105771596 missense probably benign
R5759:Dchs1 UTSW 7 105764176 missense probably damaging 0.99
R5772:Dchs1 UTSW 7 105773040 missense probably damaging 1.00
R5860:Dchs1 UTSW 7 105772035 missense probably damaging 1.00
R5916:Dchs1 UTSW 7 105759166 missense probably damaging 1.00
R5965:Dchs1 UTSW 7 105755925 missense probably damaging 1.00
R5997:Dchs1 UTSW 7 105754095 missense probably benign 0.08
R6065:Dchs1 UTSW 7 105755421 missense probably damaging 1.00
R6136:Dchs1 UTSW 7 105760925 missense probably benign
R6137:Dchs1 UTSW 7 105765106 missense probably damaging 0.99
R6324:Dchs1 UTSW 7 105764938 missense probably benign 0.05
R6363:Dchs1 UTSW 7 105758472 missense probably benign 0.12
R6466:Dchs1 UTSW 7 105764541 missense probably benign 0.09
R6544:Dchs1 UTSW 7 105758178 missense probably damaging 1.00
R6572:Dchs1 UTSW 7 105758806 missense possibly damaging 0.94
R6579:Dchs1 UTSW 7 105762913 missense probably benign 0.17
R6632:Dchs1 UTSW 7 105761878 missense probably damaging 1.00
R6725:Dchs1 UTSW 7 105758793 missense probably damaging 0.99
R6789:Dchs1 UTSW 7 105757003 missense possibly damaging 0.61
R6868:Dchs1 UTSW 7 105763503 missense possibly damaging 0.91
R7058:Dchs1 UTSW 7 105757021 missense probably benign
R7064:Dchs1 UTSW 7 105763185 missense probably damaging 0.99
R7076:Dchs1 UTSW 7 105761871 missense probably benign 0.04
R7191:Dchs1 UTSW 7 105765439 missense possibly damaging 0.89
R7298:Dchs1 UTSW 7 105755131 nonsense probably null
R7380:Dchs1 UTSW 7 105758628 missense probably benign 0.35
R7438:Dchs1 UTSW 7 105754948 missense probably benign 0.30
R7496:Dchs1 UTSW 7 105761859 missense probably damaging 1.00
R7534:Dchs1 UTSW 7 105772373 missense probably benign 0.00
R7604:Dchs1 UTSW 7 105765982 missense probably damaging 1.00
R7631:Dchs1 UTSW 7 105759238 missense probably benign
R7821:Dchs1 UTSW 7 105765145 missense probably benign 0.00
R7841:Dchs1 UTSW 7 105762973 missense probably benign
R7913:Dchs1 UTSW 7 105759228 missense possibly damaging 0.61
R7917:Dchs1 UTSW 7 105765567 missense probably benign 0.39
R7924:Dchs1 UTSW 7 105762973 missense probably benign
R7994:Dchs1 UTSW 7 105759228 missense possibly damaging 0.61
R8041:Dchs1 UTSW 7 105755188 missense probably benign 0.45
R8076:Dchs1 UTSW 7 105755921 missense possibly damaging 0.52
R8076:Dchs1 UTSW 7 105761982 missense probably damaging 1.00
R8087:Dchs1 UTSW 7 105753499 missense probably benign 0.41
R8125:Dchs1 UTSW 7 105764882 missense possibly damaging 0.91
R8223:Dchs1 UTSW 7 105762617 missense possibly damaging 0.81
R8239:Dchs1 UTSW 7 105765511 missense probably benign 0.22
Z1177:Dchs1 UTSW 7 105757693 missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105758551 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGGTATGCTGTTCTAGGGTCAC -3'
(R):5'- TCACCAGTACCTGCTACCAG -3'

Sequencing Primer
(F):5'- CACCCTGAGATGGTACTAGGATATC -3'
(R):5'- AGTACCTGCTACCAGCCTCC -3'
Posted On2019-12-20